ID: 937656201

View in Genome Browser
Species Human (GRCh38)
Location 2:124379694-124379716
Sequence GCTGCCAGACCTCACAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656201_937656205 -10 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656205 2:124379707-124379729 GTCTGGCAGCGCCCTCACAAGGG No data
937656201_937656208 10 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656208 2:124379727-124379749 GGGAGTTTTGTAACCAGCCCTGG No data
937656201_937656209 11 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656209 2:124379728-124379750 GGAGTTTTGTAACCAGCCCTGGG No data
937656201_937656213 30 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656201 Original CRISPR GCTGCCAGACCTCACAAGGG AGG (reversed) Intronic
No off target data available for this crispr