ID: 937656203

View in Genome Browser
Species Human (GRCh38)
Location 2:124379698-124379720
Sequence GGGCGCTGCCAGACCTCACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656203_937656209 7 Left 937656203 2:124379698-124379720 CCTTGTGAGGTCTGGCAGCGCCC No data
Right 937656209 2:124379728-124379750 GGAGTTTTGTAACCAGCCCTGGG No data
937656203_937656208 6 Left 937656203 2:124379698-124379720 CCTTGTGAGGTCTGGCAGCGCCC No data
Right 937656208 2:124379727-124379749 GGGAGTTTTGTAACCAGCCCTGG No data
937656203_937656213 26 Left 937656203 2:124379698-124379720 CCTTGTGAGGTCTGGCAGCGCCC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656203 Original CRISPR GGGCGCTGCCAGACCTCACA AGG (reversed) Intronic
No off target data available for this crispr