ID: 937656205

View in Genome Browser
Species Human (GRCh38)
Location 2:124379707-124379729
Sequence GTCTGGCAGCGCCCTCACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656195_937656205 29 Left 937656195 2:124379655-124379677 CCTTGGGTTGCTGCTAACATTTT No data
Right 937656205 2:124379707-124379729 GTCTGGCAGCGCCCTCACAAGGG No data
937656201_937656205 -10 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656205 2:124379707-124379729 GTCTGGCAGCGCCCTCACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656205 Original CRISPR GTCTGGCAGCGCCCTCACAA GGG Intronic
No off target data available for this crispr