ID: 937656208

View in Genome Browser
Species Human (GRCh38)
Location 2:124379727-124379749
Sequence GGGAGTTTTGTAACCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656201_937656208 10 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656208 2:124379727-124379749 GGGAGTTTTGTAACCAGCCCTGG No data
937656203_937656208 6 Left 937656203 2:124379698-124379720 CCTTGTGAGGTCTGGCAGCGCCC No data
Right 937656208 2:124379727-124379749 GGGAGTTTTGTAACCAGCCCTGG No data
937656202_937656208 7 Left 937656202 2:124379697-124379719 CCCTTGTGAGGTCTGGCAGCGCC No data
Right 937656208 2:124379727-124379749 GGGAGTTTTGTAACCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656208 Original CRISPR GGGAGTTTTGTAACCAGCCC TGG Intronic
No off target data available for this crispr