ID: 937656213

View in Genome Browser
Species Human (GRCh38)
Location 2:124379747-124379769
Sequence TGGGATTTTGCTCCTGTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937656207_937656213 5 Left 937656207 2:124379719-124379741 CCTCACAAGGGAGTTTTGTAACC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data
937656201_937656213 30 Left 937656201 2:124379694-124379716 CCTCCCTTGTGAGGTCTGGCAGC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data
937656202_937656213 27 Left 937656202 2:124379697-124379719 CCCTTGTGAGGTCTGGCAGCGCC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data
937656206_937656213 6 Left 937656206 2:124379718-124379740 CCCTCACAAGGGAGTTTTGTAAC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data
937656203_937656213 26 Left 937656203 2:124379698-124379720 CCTTGTGAGGTCTGGCAGCGCCC No data
Right 937656213 2:124379747-124379769 TGGGATTTTGCTCCTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937656213 Original CRISPR TGGGATTTTGCTCCTGTCAG TGG Intronic
No off target data available for this crispr