ID: 937659692

View in Genome Browser
Species Human (GRCh38)
Location 2:124416647-124416669
Sequence CCTAGAAAGAGAAAAAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937659692_937659697 21 Left 937659692 2:124416647-124416669 CCTTCCCTTTTTCTCTTTCTAGG No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data
937659692_937659696 6 Left 937659692 2:124416647-124416669 CCTTCCCTTTTTCTCTTTCTAGG No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937659692 Original CRISPR CCTAGAAAGAGAAAAAGGGA AGG (reversed) Intronic