ID: 937659694

View in Genome Browser
Species Human (GRCh38)
Location 2:124416651-124416673
Sequence GAAGCCTAGAAAGAGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937659694_937659696 2 Left 937659694 2:124416651-124416673 CCCTTTTTCTCTTTCTAGGCTTC No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG 0: 3
1: 4
2: 41
3: 304
4: 2036
937659694_937659697 17 Left 937659694 2:124416651-124416673 CCCTTTTTCTCTTTCTAGGCTTC No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937659694 Original CRISPR GAAGCCTAGAAAGAGAAAAA GGG (reversed) Intronic
No off target data available for this crispr