ID: 937659695

View in Genome Browser
Species Human (GRCh38)
Location 2:124416652-124416674
Sequence AGAAGCCTAGAAAGAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937659695_937659696 1 Left 937659695 2:124416652-124416674 CCTTTTTCTCTTTCTAGGCTTCT No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG 0: 3
1: 4
2: 41
3: 304
4: 2036
937659695_937659697 16 Left 937659695 2:124416652-124416674 CCTTTTTCTCTTTCTAGGCTTCT No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937659695 Original CRISPR AGAAGCCTAGAAAGAGAAAA AGG (reversed) Intronic
No off target data available for this crispr