ID: 937659696

View in Genome Browser
Species Human (GRCh38)
Location 2:124416676-124416698
Sequence TTTTTAAAAAATCTGTAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2388
Summary {0: 3, 1: 4, 2: 41, 3: 304, 4: 2036}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937659694_937659696 2 Left 937659694 2:124416651-124416673 CCCTTTTTCTCTTTCTAGGCTTC No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG 0: 3
1: 4
2: 41
3: 304
4: 2036
937659692_937659696 6 Left 937659692 2:124416647-124416669 CCTTCCCTTTTTCTCTTTCTAGG No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG 0: 3
1: 4
2: 41
3: 304
4: 2036
937659695_937659696 1 Left 937659695 2:124416652-124416674 CCTTTTTCTCTTTCTAGGCTTCT No data
Right 937659696 2:124416676-124416698 TTTTTAAAAAATCTGTAAAATGG 0: 3
1: 4
2: 41
3: 304
4: 2036

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937659696 Original CRISPR TTTTTAAAAAATCTGTAAAA TGG Intronic
Too many off-targets to display for this crispr