ID: 937659697

View in Genome Browser
Species Human (GRCh38)
Location 2:124416691-124416713
Sequence TAAAATGGTGATAATGATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937659695_937659697 16 Left 937659695 2:124416652-124416674 CCTTTTTCTCTTTCTAGGCTTCT No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data
937659692_937659697 21 Left 937659692 2:124416647-124416669 CCTTCCCTTTTTCTCTTTCTAGG No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data
937659694_937659697 17 Left 937659694 2:124416651-124416673 CCCTTTTTCTCTTTCTAGGCTTC No data
Right 937659697 2:124416691-124416713 TAAAATGGTGATAATGATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937659697 Original CRISPR TAAAATGGTGATAATGATAA TGG Intronic
No off target data available for this crispr