ID: 937660432

View in Genome Browser
Species Human (GRCh38)
Location 2:124424343-124424365
Sequence CTCTGTCAGCCCTCCAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937660426_937660432 22 Left 937660426 2:124424298-124424320 CCATACAGCCCTATCACAGGGAA No data
Right 937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG No data
937660425_937660432 23 Left 937660425 2:124424297-124424319 CCCATACAGCCCTATCACAGGGA No data
Right 937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG No data
937660428_937660432 13 Left 937660428 2:124424307-124424329 CCTATCACAGGGAACTTCAGAAG No data
Right 937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG No data
937660427_937660432 14 Left 937660427 2:124424306-124424328 CCCTATCACAGGGAACTTCAGAA No data
Right 937660432 2:124424343-124424365 CTCTGTCAGCCCTCCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937660432 Original CRISPR CTCTGTCAGCCCTCCAAGTG GGG Intronic
No off target data available for this crispr