ID: 937665586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:124483340-124483362 |
Sequence | ATTACTTGATATGTAGCCAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937665586_937665589 | 4 | Left | 937665586 | 2:124483340-124483362 | CCAGTGGCTACATATCAAGTAAT | No data | ||
Right | 937665589 | 2:124483367-124483389 | AAGGCTGAAATTGTTAAAAATGG | No data | ||||
937665586_937665590 | 22 | Left | 937665586 | 2:124483340-124483362 | CCAGTGGCTACATATCAAGTAAT | No data | ||
Right | 937665590 | 2:124483385-124483407 | AATGGAATCACCATTAGCGCAGG | No data | ||||
937665586_937665591 | 26 | Left | 937665586 | 2:124483340-124483362 | CCAGTGGCTACATATCAAGTAAT | No data | ||
Right | 937665591 | 2:124483389-124483411 | GAATCACCATTAGCGCAGGCCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937665586 | Original CRISPR | ATTACTTGATATGTAGCCAC TGG (reversed) | Intronic | ||