ID: 937665589

View in Genome Browser
Species Human (GRCh38)
Location 2:124483367-124483389
Sequence AAGGCTGAAATTGTTAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937665584_937665589 21 Left 937665584 2:124483323-124483345 CCACTAGGAGCTTGGGACCAGTG No data
Right 937665589 2:124483367-124483389 AAGGCTGAAATTGTTAAAAATGG No data
937665586_937665589 4 Left 937665586 2:124483340-124483362 CCAGTGGCTACATATCAAGTAAT No data
Right 937665589 2:124483367-124483389 AAGGCTGAAATTGTTAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937665589 Original CRISPR AAGGCTGAAATTGTTAAAAA TGG Intronic
No off target data available for this crispr