ID: 937665591

View in Genome Browser
Species Human (GRCh38)
Location 2:124483389-124483411
Sequence GAATCACCATTAGCGCAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937665586_937665591 26 Left 937665586 2:124483340-124483362 CCAGTGGCTACATATCAAGTAAT No data
Right 937665591 2:124483389-124483411 GAATCACCATTAGCGCAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937665591 Original CRISPR GAATCACCATTAGCGCAGGC CGG Intronic
No off target data available for this crispr