ID: 937666900

View in Genome Browser
Species Human (GRCh38)
Location 2:124498313-124498335
Sequence AGCTGTATGAGGAACTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937666900_937666904 30 Left 937666900 2:124498313-124498335 CCATTGTAGTTCCTCATACAGCT No data
Right 937666904 2:124498366-124498388 TATTTTAGGCTACAGTTTCTGGG No data
937666900_937666902 16 Left 937666900 2:124498313-124498335 CCATTGTAGTTCCTCATACAGCT No data
Right 937666902 2:124498352-124498374 TTCTCTTTGTAAAATATTTTAGG No data
937666900_937666903 29 Left 937666900 2:124498313-124498335 CCATTGTAGTTCCTCATACAGCT No data
Right 937666903 2:124498365-124498387 ATATTTTAGGCTACAGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937666900 Original CRISPR AGCTGTATGAGGAACTACAA TGG (reversed) Intronic
No off target data available for this crispr