ID: 937671847

View in Genome Browser
Species Human (GRCh38)
Location 2:124546560-124546582
Sequence ACCCCTTGGGCTGCTCATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937671842_937671847 10 Left 937671842 2:124546527-124546549 CCTAGAGTGAATAAATCACAGTA No data
Right 937671847 2:124546560-124546582 ACCCCTTGGGCTGCTCATTGTGG No data
937671841_937671847 11 Left 937671841 2:124546526-124546548 CCCTAGAGTGAATAAATCACAGT No data
Right 937671847 2:124546560-124546582 ACCCCTTGGGCTGCTCATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937671847 Original CRISPR ACCCCTTGGGCTGCTCATTG TGG Intronic
No off target data available for this crispr