ID: 937672574

View in Genome Browser
Species Human (GRCh38)
Location 2:124553955-124553977
Sequence AGGTGCCGATGGGAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937672568_937672574 16 Left 937672568 2:124553916-124553938 CCAAAGGTGGGATTTAAGAACAG No data
Right 937672574 2:124553955-124553977 AGGTGCCGATGGGAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937672574 Original CRISPR AGGTGCCGATGGGAGTGTTC TGG Intronic
No off target data available for this crispr