ID: 937675396

View in Genome Browser
Species Human (GRCh38)
Location 2:124584477-124584499
Sequence ATGCCATGAGCTACACTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937675396_937675399 26 Left 937675396 2:124584477-124584499 CCTCTAAGTGTAGCTCATGGCAT No data
Right 937675399 2:124584526-124584548 ATGTGAACTGCACAAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937675396 Original CRISPR ATGCCATGAGCTACACTTAG AGG (reversed) Intronic