ID: 937679464

View in Genome Browser
Species Human (GRCh38)
Location 2:124628071-124628093
Sequence AGACTGAGCCTACTACTGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937679462_937679464 5 Left 937679462 2:124628043-124628065 CCTCCAAGAATTATGGTGCTATG No data
Right 937679464 2:124628071-124628093 AGACTGAGCCTACTACTGATTGG No data
937679463_937679464 2 Left 937679463 2:124628046-124628068 CCAAGAATTATGGTGCTATGTAA No data
Right 937679464 2:124628071-124628093 AGACTGAGCCTACTACTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937679464 Original CRISPR AGACTGAGCCTACTACTGAT TGG Intronic
No off target data available for this crispr