ID: 937680219

View in Genome Browser
Species Human (GRCh38)
Location 2:124635539-124635561
Sequence CAAGTCCTCCTGACTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937680215_937680219 30 Left 937680215 2:124635486-124635508 CCTTGTTGAGCTCAGCAGGATCA No data
Right 937680219 2:124635539-124635561 CAAGTCCTCCTGACTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937680219 Original CRISPR CAAGTCCTCCTGACTTCCCT GGG Intronic
No off target data available for this crispr