ID: 937680642

View in Genome Browser
Species Human (GRCh38)
Location 2:124640699-124640721
Sequence TCTGGGAACCTTTACTGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937680642_937680648 18 Left 937680642 2:124640699-124640721 CCCCCTCAGTAAAGGTTCCCAGA No data
Right 937680648 2:124640740-124640762 ATAATCTCTTCACATCCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937680642 Original CRISPR TCTGGGAACCTTTACTGAGG GGG (reversed) Intronic
No off target data available for this crispr