ID: 937681825

View in Genome Browser
Species Human (GRCh38)
Location 2:124652406-124652428
Sequence CCCACTGAAAAAGGCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937681821_937681825 8 Left 937681821 2:124652375-124652397 CCTTGTCACAGGGAAGGAGACAA No data
Right 937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG No data
937681817_937681825 23 Left 937681817 2:124652360-124652382 CCAGTACTCACAGTACCTTGTCA No data
Right 937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG No data
937681816_937681825 27 Left 937681816 2:124652356-124652378 CCTGCCAGTACTCACAGTACCTT No data
Right 937681825 2:124652406-124652428 CCCACTGAAAAAGGCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937681825 Original CRISPR CCCACTGAAAAAGGCTACCT TGG Intronic
No off target data available for this crispr