ID: 937683349

View in Genome Browser
Species Human (GRCh38)
Location 2:124668205-124668227
Sequence CTGTAGTCATACATTTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937683347_937683349 2 Left 937683347 2:124668180-124668202 CCTTACATCCATCTGTTAAAGCA No data
Right 937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG No data
937683346_937683349 11 Left 937683346 2:124668171-124668193 CCATGAGGGCCTTACATCCATCT No data
Right 937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG No data
937683348_937683349 -6 Left 937683348 2:124668188-124668210 CCATCTGTTAAAGCATGCTGTAG No data
Right 937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937683349 Original CRISPR CTGTAGTCATACATTTAGCT AGG Intronic
No off target data available for this crispr