ID: 937683790

View in Genome Browser
Species Human (GRCh38)
Location 2:124672712-124672734
Sequence GATTTTTATTCCATCCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937683790_937683792 5 Left 937683790 2:124672712-124672734 CCAATCAGGATGGAATAAAAATC No data
Right 937683792 2:124672740-124672762 TATAAATATGTTCAATAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937683790 Original CRISPR GATTTTTATTCCATCCTGAT TGG (reversed) Intronic
No off target data available for this crispr