ID: 937685097

View in Genome Browser
Species Human (GRCh38)
Location 2:124687103-124687125
Sequence GTGTGATTAGTTGGGTACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937685093_937685097 -8 Left 937685093 2:124687088-124687110 CCTTCTAGGTTTGGCGTGTGATT No data
Right 937685097 2:124687103-124687125 GTGTGATTAGTTGGGTACCTGGG No data
937685090_937685097 12 Left 937685090 2:124687068-124687090 CCAGAGTTTGTGGCTATGTTCCT No data
Right 937685097 2:124687103-124687125 GTGTGATTAGTTGGGTACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937685097 Original CRISPR GTGTGATTAGTTGGGTACCT GGG Intronic
No off target data available for this crispr