ID: 937687667

View in Genome Browser
Species Human (GRCh38)
Location 2:124716274-124716296
Sequence GATGATGGTGCCACACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937687667_937687670 -5 Left 937687667 2:124716274-124716296 CCTAAATGTGTGGCACCATCATC No data
Right 937687670 2:124716292-124716314 TCATCCATTTAAGGAAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937687667 Original CRISPR GATGATGGTGCCACACATTT AGG (reversed) Intronic
No off target data available for this crispr