ID: 937689434 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:124738235-124738257 |
Sequence | CAGAGTGAAAAGAAAGAGGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
937689434_937689438 | 10 | Left | 937689434 | 2:124738235-124738257 | CCTCCCTCTTTCTTTTCACTCTG | No data | ||
Right | 937689438 | 2:124738268-124738290 | CTAATGCTTTTGTCGTATCAGGG | No data | ||||
937689434_937689437 | 9 | Left | 937689434 | 2:124738235-124738257 | CCTCCCTCTTTCTTTTCACTCTG | No data | ||
Right | 937689437 | 2:124738267-124738289 | ACTAATGCTTTTGTCGTATCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
937689434 | Original CRISPR | CAGAGTGAAAAGAAAGAGGG AGG (reversed) | Intronic | ||
No off target data available for this crispr |