ID: 937689434

View in Genome Browser
Species Human (GRCh38)
Location 2:124738235-124738257
Sequence CAGAGTGAAAAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937689434_937689438 10 Left 937689434 2:124738235-124738257 CCTCCCTCTTTCTTTTCACTCTG No data
Right 937689438 2:124738268-124738290 CTAATGCTTTTGTCGTATCAGGG No data
937689434_937689437 9 Left 937689434 2:124738235-124738257 CCTCCCTCTTTCTTTTCACTCTG No data
Right 937689437 2:124738267-124738289 ACTAATGCTTTTGTCGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937689434 Original CRISPR CAGAGTGAAAAGAAAGAGGG AGG (reversed) Intronic
No off target data available for this crispr