ID: 937690041

View in Genome Browser
Species Human (GRCh38)
Location 2:124745103-124745125
Sequence GGGCTGCTAATGGAACTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937690035_937690041 24 Left 937690035 2:124745056-124745078 CCAAAGCGGTGCAAGATGTTGAT No data
Right 937690041 2:124745103-124745125 GGGCTGCTAATGGAACTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937690041 Original CRISPR GGGCTGCTAATGGAACTTCT AGG Intronic
No off target data available for this crispr