ID: 937691198

View in Genome Browser
Species Human (GRCh38)
Location 2:124757333-124757355
Sequence CTGTGTGCACAGAATGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937691192_937691198 13 Left 937691192 2:124757297-124757319 CCTAGTCAATTGAGCTGTGTCTT No data
Right 937691198 2:124757333-124757355 CTGTGTGCACAGAATGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937691198 Original CRISPR CTGTGTGCACAGAATGGGGA TGG Intronic
No off target data available for this crispr