ID: 937692679

View in Genome Browser
Species Human (GRCh38)
Location 2:124773495-124773517
Sequence TGATCCCTTTCTAAATCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937692673_937692679 24 Left 937692673 2:124773448-124773470 CCATTTTAAAGGGATTTTCGTCA No data
Right 937692679 2:124773495-124773517 TGATCCCTTTCTAAATCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937692679 Original CRISPR TGATCCCTTTCTAAATCAGG GGG Intronic
No off target data available for this crispr