ID: 937695899

View in Genome Browser
Species Human (GRCh38)
Location 2:124808303-124808325
Sequence CCTGCTTTATGTCATTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695899_937695906 21 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
937695899_937695903 -10 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695903 2:124808316-124808338 ATAAAGCAGGCCAGGCACGGTGG No data
937695899_937695907 27 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695907 2:124808353-124808375 CTCAGTACTTCAGGAGGCCGAGG 0: 3
1: 57
2: 1316
3: 17430
4: 165123
937695899_937695905 18 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695899 Original CRISPR CCTGCTTTATGTCATTTTGA AGG (reversed) Intronic
No off target data available for this crispr