ID: 937695904

View in Genome Browser
Species Human (GRCh38)
Location 2:124808326-124808348
Sequence CAAGCATGAGCCACCGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 334593
Summary {0: 237, 1: 8658, 2: 46271, 3: 118247, 4: 161180}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695907 4 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695907 2:124808353-124808375 CTCAGTACTTCAGGAGGCCGAGG 0: 3
1: 57
2: 1316
3: 17430
4: 165123
937695904_937695910 27 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695910 2:124808376-124808398 TCAGGAGTTCGAGACCAGCCTGG 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849
937695904_937695906 -2 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
937695904_937695908 9 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695908 2:124808358-124808380 TACTTCAGGAGGCCGAGGTCAGG No data
937695904_937695905 -5 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695904 Original CRISPR CAAGCATGAGCCACCGTGCC TGG (reversed) Intronic
Too many off-targets to display for this crispr