ID: 937695904

View in Genome Browser
Species Human (GRCh38)
Location 2:124808326-124808348
Sequence CAAGCATGAGCCACCGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695905 -5 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG No data
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data
937695904_937695910 27 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG No data
Right 937695910 2:124808376-124808398 TCAGGAGTTCGAGACCAGCCTGG No data
937695904_937695907 4 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG No data
Right 937695907 2:124808353-124808375 CTCAGTACTTCAGGAGGCCGAGG No data
937695904_937695908 9 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG No data
Right 937695908 2:124808358-124808380 TACTTCAGGAGGCCGAGGTCAGG No data
937695904_937695906 -2 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG No data
Right 937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695904 Original CRISPR CAAGCATGAGCCACCGTGCC TGG (reversed) Intronic