ID: 937695905

View in Genome Browser
Species Human (GRCh38)
Location 2:124808344-124808366
Sequence GCTTGTAATCTCAGTACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695905 -5 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data
937695899_937695905 18 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data
937695898_937695905 30 Left 937695898 2:124808291-124808313 CCTTCTTAAACTCCTTCAAAATG No data
Right 937695905 2:124808344-124808366 GCTTGTAATCTCAGTACTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695905 Original CRISPR GCTTGTAATCTCAGTACTTC AGG Intronic
No off target data available for this crispr