ID: 937695906

View in Genome Browser
Species Human (GRCh38)
Location 2:124808347-124808369
Sequence TGTAATCTCAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695906 -2 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
937695899_937695906 21 Left 937695899 2:124808303-124808325 CCTTCAAAATGACATAAAGCAGG No data
Right 937695906 2:124808347-124808369 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695906 Original CRISPR TGTAATCTCAGTACTTCAGG AGG Intronic
Too many off-targets to display for this crispr