ID: 937695908

View in Genome Browser
Species Human (GRCh38)
Location 2:124808358-124808380
Sequence TACTTCAGGAGGCCGAGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695908 9 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695908 2:124808358-124808380 TACTTCAGGAGGCCGAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695908 Original CRISPR TACTTCAGGAGGCCGAGGTC AGG Intronic
No off target data available for this crispr