ID: 937695910

View in Genome Browser
Species Human (GRCh38)
Location 2:124808376-124808398
Sequence TCAGGAGTTCGAGACCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 700872
Summary {0: 51840, 1: 157012, 2: 220107, 3: 177064, 4: 94849}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937695904_937695910 27 Left 937695904 2:124808326-124808348 CCAGGCACGGTGGCTCATGCTTG 0: 237
1: 8658
2: 46271
3: 118247
4: 161180
Right 937695910 2:124808376-124808398 TCAGGAGTTCGAGACCAGCCTGG 0: 51840
1: 157012
2: 220107
3: 177064
4: 94849

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937695910 Original CRISPR TCAGGAGTTCGAGACCAGCC TGG Intronic
Too many off-targets to display for this crispr