ID: 937699489

View in Genome Browser
Species Human (GRCh38)
Location 2:124847592-124847614
Sequence GGAACTGGATCACCACTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937699489_937699497 12 Left 937699489 2:124847592-124847614 CCCTGCAGTGGTGATCCAGTTCC No data
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699489_937699494 -7 Left 937699489 2:124847592-124847614 CCCTGCAGTGGTGATCCAGTTCC No data
Right 937699494 2:124847608-124847630 CAGTTCCTTCAAAGGGTCTGTGG 0: 59
1: 95
2: 231
3: 332
4: 596
937699489_937699495 -6 Left 937699489 2:124847592-124847614 CCCTGCAGTGGTGATCCAGTTCC No data
Right 937699495 2:124847609-124847631 AGTTCCTTCAAAGGGTCTGTGGG No data
937699489_937699498 25 Left 937699489 2:124847592-124847614 CCCTGCAGTGGTGATCCAGTTCC No data
Right 937699498 2:124847640-124847662 GCTTTCCTGGTACGTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937699489 Original CRISPR GGAACTGGATCACCACTGCA GGG (reversed) Intronic
No off target data available for this crispr