ID: 937699490

View in Genome Browser
Species Human (GRCh38)
Location 2:124847593-124847615
Sequence AGGAACTGGATCACCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 19, 1: 20, 2: 55, 3: 56, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937699490_937699494 -8 Left 937699490 2:124847593-124847615 CCTGCAGTGGTGATCCAGTTCCT 0: 19
1: 20
2: 55
3: 56
4: 171
Right 937699494 2:124847608-124847630 CAGTTCCTTCAAAGGGTCTGTGG 0: 59
1: 95
2: 231
3: 332
4: 596
937699490_937699497 11 Left 937699490 2:124847593-124847615 CCTGCAGTGGTGATCCAGTTCCT 0: 19
1: 20
2: 55
3: 56
4: 171
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699490_937699495 -7 Left 937699490 2:124847593-124847615 CCTGCAGTGGTGATCCAGTTCCT 0: 19
1: 20
2: 55
3: 56
4: 171
Right 937699495 2:124847609-124847631 AGTTCCTTCAAAGGGTCTGTGGG No data
937699490_937699498 24 Left 937699490 2:124847593-124847615 CCTGCAGTGGTGATCCAGTTCCT 0: 19
1: 20
2: 55
3: 56
4: 171
Right 937699498 2:124847640-124847662 GCTTTCCTGGTACGTTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937699490 Original CRISPR AGGAACTGGATCACCACTGC AGG (reversed) Intronic
900220739 1:1508238-1508260 CGGAGCTGGACCACCACTGTGGG - Intergenic
904461446 1:30682905-30682927 AGGAAATGGATCGGCACTGAAGG + Intergenic
905519181 1:38584874-38584896 AGGATCTGGATACCCACTTCTGG - Intergenic
906578932 1:46918184-46918206 AGTAACTGGATTACTGCTGCAGG - Intergenic
906594404 1:47062352-47062374 AGTAACTGGATTACTGCTGCAGG + Intergenic
906754006 1:48291723-48291745 AGGAAGTGGACTGCCACTGCAGG - Intergenic
909125366 1:71661358-71661380 AGCAGCTGGATCACCACACCAGG + Intronic
909791279 1:79680853-79680875 AGGAACTGGATTGCTGCTGCAGG - Intergenic
909948637 1:81692441-81692463 AGGAATTGGCTTAACACTGCGGG - Intronic
910708557 1:90155312-90155334 AGGAACTGAATAATCACTGCAGG - Intergenic
911265936 1:95743148-95743170 AAGAACTGGATCACGGCTGCAGG - Intergenic
911323310 1:96440393-96440415 AGGAACTGAATCACCCCTGCAGG - Intergenic
911806239 1:102211453-102211475 AGGAACTGGATCCCTGCTGCAGG - Intergenic
913502086 1:119480637-119480659 AAATACTGGGTCACCACTGCAGG - Intergenic
914396438 1:147273597-147273619 AGGCAGTGCATCATCACTGCCGG + Intronic
915436592 1:155911280-155911302 GGGGACTGGAACACCACAGCCGG + Intronic
918241190 1:182622091-182622113 AGGCACTGGATAAGCACTGGAGG + Intergenic
918589173 1:186221829-186221851 AGAAACTTGATCACCACTGCAGG + Intergenic
918819797 1:189237387-189237409 AGGAACTGGATCACCACTACAGG - Intergenic
919520636 1:198583085-198583107 AGGAAATGGATCACCCCTTCAGG - Intergenic
920799887 1:209176720-209176742 AGGAACTGGATTGCCGCTGAAGG + Intergenic
920989709 1:210925385-210925407 AGGAACTTGATCACTGCTACAGG + Intronic
921622681 1:217343474-217343496 AGGAACTGGATCACTTTAGCAGG - Intergenic
922319862 1:224477173-224477195 AGGAACTTCATCACCCCTGCAGG - Intronic
922997764 1:229979947-229979969 AGGACCTGGAACAACATTGCTGG + Intergenic
923440908 1:234019411-234019433 AGGAACTGGCTCACCAATTGTGG + Intronic
923450364 1:234111682-234111704 TGGGACTGGATCGTCACTGCTGG - Intronic
924321543 1:242855510-242855532 AGGAAGTGGATTACTCCTGCAGG - Intergenic
924691424 1:246355457-246355479 AGGAACTGTATCGCCACTGCAGG + Intronic
924880225 1:248152788-248152810 AGGAACTGGATCACTGATGCAGG - Intergenic
924883339 1:248187212-248187234 AGGAACTGGATCACCACTGCAGG - Intergenic
924885416 1:248210318-248210340 AGGAACTGGATCACCACTGCAGG - Intergenic
924894172 1:248317716-248317738 AGGAACTGGATCACCACTGCGGG + Intergenic
1063561357 10:7130849-7130871 AGGAACTGGAACGCTGCTGCAGG - Intergenic
1064345947 10:14533035-14533057 GGGAACTTGAACACCAGTGCTGG + Intronic
1065462297 10:25981903-25981925 AGGAACTGGATCACCTCTTCAGG + Intronic
1066162150 10:32745633-32745655 AGAAACTGGATCACCAATATTGG - Intronic
1066650946 10:37654610-37654632 AGGAGGTGGATTGCCACTGCAGG + Intergenic
1067034501 10:42903088-42903110 AGGAGGTGGATTGCCACTGCAGG + Intergenic
1069129626 10:64682435-64682457 ATGAAATGGATCACCACTGCAGG - Intergenic
1069160074 10:65082941-65082963 AGGAAGTGGTTTACCTCTGCAGG + Intergenic
1070434225 10:76372774-76372796 AGGTACTGTATCACCCCAGCAGG - Intronic
1070801060 10:79244567-79244589 AGGGACTGGGTCCCCACTGCAGG - Intronic
1072381814 10:94879903-94879925 AGGAACTGAATCGCTGCTGCAGG - Intergenic
1072732917 10:97859909-97859931 AACAACTGGATCAGCACTGCTGG - Intronic
1072769624 10:98126615-98126637 AGGAACTGGATCGCTGCTGCAGG - Intergenic
1077834320 11:5910930-5910952 AGGAACTGGATTGCTTCTGCAGG - Intronic
1081091182 11:38867742-38867764 AGGAACTGGATCTCCACTGCAGG - Intergenic
1082941101 11:58706484-58706506 AGAAACTGGATTACCTCTGCAGG + Intronic
1085240686 11:75051372-75051394 AGGAACTGGATCACCAATCCAGG - Intergenic
1086844308 11:91730036-91730058 AGGAACTAGATGGCCCCTGCAGG + Intergenic
1087866197 11:103229211-103229233 AGGAACTGGGTCACCACTGCAGG - Intronic
1088951189 11:114571811-114571833 AGGAACAGGATCACCACTGCAGG + Intronic
1089836896 11:121378822-121378844 AGAAACCGGATCACCCCTGCAGG + Intergenic
1093266998 12:17015703-17015725 TGGTACTGGTTAACCACTGCTGG - Intergenic
1095176244 12:39095578-39095600 AGGAGGTGGATTGCCACTGCAGG + Intergenic
1097537414 12:60889513-60889535 AGGAGGTGGATTGCCACTGCGGG - Intergenic
1098001114 12:65944442-65944464 AGAAACTGGAACACCACACCTGG + Intronic
1099569645 12:84300240-84300262 AGGCACTGTATCACCATGGCTGG + Intergenic
1101544496 12:105698448-105698470 AGGAACTGGATCACCACAGCAGG - Intergenic
1103226042 12:119288976-119288998 AAGAACTTGGACACCACTGCTGG - Intergenic
1106142453 13:27022633-27022655 AGCTACTGACTCACCACTGCAGG - Intergenic
1108298775 13:49053200-49053222 AGCAACTGTATCACCACTGCAGG - Intronic
1108831613 13:54486696-54486718 AGAAACTGGATCACTGCTACAGG + Intergenic
1109201379 13:59435211-59435233 AGGAGGTGGATTGCCACTGCAGG - Intergenic
1110181743 13:72625802-72625824 AGGAACTGGATCACTTCTGCAGG + Intergenic
1110340971 13:74389221-74389243 AGGAACTGCATCACTGCTACAGG - Intergenic
1110376036 13:74794632-74794654 AGGAAATGGATCAATGCTGCAGG - Intergenic
1112540427 13:100306300-100306322 AGGAACTGAATCAAAGCTGCTGG - Intronic
1116217100 14:42030830-42030852 TGGGACTGGATGACAACTGCAGG - Intergenic
1117103832 14:52378656-52378678 AGGAACTGGGTCACTGCTGCAGG - Intergenic
1119834127 14:77732269-77732291 GGGAGCCGGATCACCACTGTGGG + Intronic
1120400384 14:84023297-84023319 AGGAACTACATCACTGCTGCAGG - Intergenic
1120450969 14:84666217-84666239 AGGAACTAGATCACTGCTGCAGG - Intergenic
1120736416 14:88057836-88057858 AGAAACTGGATCGCCATAGCAGG - Intergenic
1121668992 14:95693696-95693718 AGGAGCTGGGTGAGCACTGCAGG + Intergenic
1121848489 14:97196750-97196772 AGGAGCTGGATCATCGCTGCAGG - Intergenic
1124504964 15:30264717-30264739 AGGAACTGGATCCCTGCTACAGG + Intergenic
1124738588 15:32273918-32273940 AGGAACTGGATCCCTGCTACAGG - Intergenic
1124891477 15:33737834-33737856 AGGACATGGATCACACCTGCTGG + Intronic
1125247055 15:37652808-37652830 AGGAACTGAATCACAGCTGGAGG + Intergenic
1126184880 15:45822020-45822042 AGGAACTGGATCACTGCTGCAGG - Intergenic
1126977260 15:54197836-54197858 AGGAACTGGATCACTGCTGCAGG + Intronic
1128981467 15:72190476-72190498 TAAAACTGGATCTCCACTGCTGG + Intronic
1132643301 16:987764-987786 TGGAACGGGATCCCCACTGTGGG - Intergenic
1132842488 16:1984787-1984809 AGGAACTGGGCCGCCACAGCTGG + Exonic
1133214358 16:4282502-4282524 ATGAACTGGGTCACAGCTGCAGG - Intergenic
1133237670 16:4395136-4395158 AGGAGGTGGACCACCACTGCTGG - Intronic
1134767796 16:16776585-16776607 AGGAACTTGATGACCGCTTCTGG + Intergenic
1141248150 16:82330004-82330026 TGCAACTTGATCTCCACTGCAGG + Intergenic
1142075701 16:88116382-88116404 AGGACCTGGACCTCCATTGCTGG + Intronic
1143088446 17:4434145-4434167 ATGAACTGGTTCATCATTGCAGG + Exonic
1149493187 17:57099753-57099775 ATGCACAGAATCACCACTGCAGG - Intronic
1149695533 17:58613330-58613352 AGAAATGGGATCACCACAGCTGG + Intronic
1151078746 17:71304423-71304445 AAGAACTGGATCATCGCTGCAGG + Intergenic
1152634066 17:81423296-81423318 GGGAACTGGCTCAGCACAGCAGG + Intronic
1152822520 17:82444576-82444598 TGGAGCAGGACCACCACTGCGGG + Exonic
1154041100 18:10857036-10857058 GGCAACATGATCACCACTGCTGG - Exonic
1156642482 18:39119347-39119369 AGGAACTGGATTATCCCTGAAGG + Intergenic
1157670916 18:49527876-49527898 AGTAACTGGATGGCCACAGCAGG + Intergenic
1157703350 18:49779562-49779584 AGGAACTGGATCACTGCTGCAGG - Intergenic
1158814376 18:61076709-61076731 AGTAACCGCATCCCCACTGCGGG + Intergenic
1159838401 18:73369094-73369116 AGGAACCGGATCACCACTGTAGG + Intergenic
1164117206 19:22234173-22234195 AGGAACTGTAGCGCCACAGCTGG + Intergenic
925652374 2:6104642-6104664 GGGAACTGGATCGCTGCTGCAGG - Intergenic
925795717 2:7539997-7540019 GGGAACTGGATCACCGCTGTAGG - Intergenic
926425758 2:12737147-12737169 ATGAGCTGCATCACCACTGCAGG + Intronic
926697488 2:15780857-15780879 AGGAACTTGACCATGACTGCAGG - Intergenic
927176877 2:20415990-20416012 AGGAACTAGATCACTGCTGCGGG - Intergenic
928783128 2:34848871-34848893 AGGAAATGGATCACTGCTGCAGG - Intergenic
929197067 2:39196001-39196023 AGAAGGTGGATTACCACTGCAGG + Intronic
929938099 2:46309699-46309721 AGGAACTGGCTCACCAGTCCTGG - Intronic
930208169 2:48609082-48609104 AGGGACTGGAGCATCACTGATGG - Intronic
930593064 2:53353352-53353374 AGGAACTGGATTGCCACTGCAGG + Intergenic
932139705 2:69264476-69264498 AGGATCTGGGTCACCCCTTCAGG + Intergenic
936850689 2:116894794-116894816 AGGAACTGGATTGCCACTGAAGG + Intergenic
937008008 2:118535719-118535741 AGGGGCTGGACCAGCACTGCTGG - Intergenic
937699490 2:124847593-124847615 AGGAACTGGATCACCACTGCAGG - Intronic
938459170 2:131486538-131486560 AGGGACTGGGTCACTACTGAGGG - Intronic
938564298 2:132504071-132504093 AGAAACTGGATTACCCCTGCAGG - Intronic
938674164 2:133614123-133614145 AGAAACTGGGTCACCATTACAGG + Intergenic
938996330 2:136682933-136682955 AGGAACTGGATCACCACTGCAGG + Intergenic
940045976 2:149409904-149409926 AGGAACTGAATCACTGCTGCAGG - Intronic
940423788 2:153508695-153508717 AGGAACTGGATCACTGCTGCAGG - Intergenic
941236696 2:162984014-162984036 AGGTACTGCACCACCACTCCTGG + Intergenic
942267184 2:174240319-174240341 TGACACTGGATCACCACTGTGGG + Intronic
944073182 2:195695582-195695604 AGGAACTGGATTGCCTCTGCAGG - Intronic
944485323 2:200199578-200199600 AGGAATTGGATCACCTCTGCAGG + Intergenic
945377350 2:209094467-209094489 AGGAACTGGATCACCGCTGTTGG - Intergenic
947676247 2:231983431-231983453 AGGAACTGGGCCACAACAGCAGG + Intronic
948223312 2:236290295-236290317 GGGAAGGGGATTACCACTGCAGG - Intergenic
948745590 2:240090751-240090773 AGGAACCAGATCACCAATGAGGG + Intergenic
1169626306 20:7573722-7573744 TGGAACTGGAACTCCACTACTGG - Intergenic
1170086206 20:12535264-12535286 AGGATCTGGATGGCCACTGCAGG + Intergenic
1170727661 20:18943956-18943978 AGAAACTGGATCACTGCTGCAGG - Intergenic
1172052594 20:32130045-32130067 ATAAACTGGAACACTACTGCGGG - Intronic
1172851498 20:37969454-37969476 AGGAACTGGATCACTGCTGCAGG - Intergenic
1173426816 20:42950433-42950455 AGGGACAGGATTACCAGTGCAGG - Intronic
1177127681 21:17216774-17216796 AGGAACTGAATCACCAATGCAGG + Intergenic
1177578827 21:22993851-22993873 AGGAGGTGGATTACCGCTGCAGG + Intergenic
1178408152 21:32342294-32342316 TGGAACTGGATGATCAATGCTGG + Intronic
1181347159 22:22228190-22228212 AGGCATTGAGTCACCACTGCTGG + Intergenic
1185018219 22:48358115-48358137 AGGCACAGGCTCCCCACTGCCGG + Intergenic
949189549 3:1235720-1235742 AAGAACTGGATCACCGCTGCAGG + Intronic
951302717 3:21017922-21017944 AGGAACTGGATCACCGCTGCAGG - Intergenic
951750136 3:26025657-26025679 AGGAACTGGATCACCACTGCAGG - Intergenic
952024032 3:29057395-29057417 AGGAGGTGGATTGCCACTGCAGG + Intergenic
959361694 3:105402397-105402419 AGGAACTGTATCACTGCTGCAGG + Intronic
959437070 3:106328872-106328894 AAAAACAGAATCACCACTGCAGG + Intergenic
959757397 3:109915137-109915159 AGGAACTGGATCACCACTGCAGG - Intergenic
960064299 3:113354307-113354329 AGGAACTGGATCACCCATGCAGG + Intronic
960711942 3:120538990-120539012 GGGAACTGTATCACAAATGCAGG - Intergenic
961968016 3:130926104-130926126 AGAAATTGGATCACCACTGCAGG - Intronic
962012624 3:131407838-131407860 AGGAGGTGGATTGCCACTGCAGG + Intergenic
962034400 3:131636149-131636171 AGGAACTGGATCACTGCTGCAGG + Intronic
963373929 3:144438383-144438405 AGGAACTGGATCACTGCTGCAGG - Intergenic
963522570 3:146373342-146373364 AGAAACTGGATTGCCACTGTAGG - Intergenic
963790930 3:149581813-149581835 GGGAGATGGATCACCACAGCTGG - Intronic
963832404 3:150022547-150022569 AGCAACTGGATCACTGCTTCAGG + Intronic
963832414 3:150022653-150022675 AGGAACTGGATCACTGCTGCAGG + Intronic
964017436 3:151964693-151964715 AGGAACTGGATCACCACTGCAGG + Intergenic
964226402 3:154408338-154408360 AGGAATTGGATCACCACTGCAGG + Intronic
964299292 3:155270736-155270758 AAGAACTGGATCACCATGGCAGG + Intergenic
964794007 3:160478502-160478524 AGAAACTGGATTACTGCTGCAGG + Intronic
965132876 3:164723848-164723870 AGGAACTGGATTGCCACTACAGG - Intergenic
965184507 3:165446216-165446238 AGGATCTTGATCACCACCGCAGG + Intergenic
966229970 3:177641055-177641077 AGGAACTGGATCACTGCTGCAGG - Intergenic
970282895 4:14478181-14478203 ATGAACTAGATCACCACTGCAGG + Intergenic
973676098 4:53264274-53264296 AGGAACTGGATCACTACTGCAGG - Intronic
974985680 4:69023500-69023522 AGGAACTGGATCACCACTGCAGG - Intronic
975025946 4:69549222-69549244 AGGAACTGGACAACCACTTTTGG - Intergenic
975203045 4:71614499-71614521 AGGAACTGGATCACTGCTGCAGG + Intergenic
975365255 4:73521212-73521234 AGGAACTGGATCACCCCTGCAGG - Intergenic
975809921 4:78156873-78156895 AGGACATGGAACAGCACTGCTGG - Intronic
976918092 4:90403975-90403997 AGGAATTGGATCACCGCCACAGG + Intronic
977489200 4:97691174-97691196 AGGAGGTGGATTGCCACTGCAGG + Intronic
977853418 4:101858164-101858186 AAGAAGTGGCTCTCCACTGCAGG + Intronic
977976170 4:103269164-103269186 AGGAACTGGATCACTGCTGCAGG - Intergenic
978202015 4:106033165-106033187 AGGAACTGGATCACTACTGCAGG - Intergenic
979030221 4:115633776-115633798 AGGAACTGGATCACCACTGCAGG - Intergenic
980410007 4:132404298-132404320 AGGAACTGGATCACGGCTGCAGG - Intergenic
980645023 4:135632937-135632959 AGGAACTGGATTATCACTGCAGG - Intergenic
980761483 4:137239231-137239253 AGGAACTGGGACACCATTGCAGG - Intergenic
980861107 4:138500365-138500387 AGGAACTGGATCGCCACTGTGGG - Intergenic
982053015 4:151522224-151522246 AGAAACTGGATCAGCACTGAAGG - Intronic
982944715 4:161605707-161605729 AGGAAATGGTTCTCCACTGAAGG - Intronic
982991762 4:162285793-162285815 AGGAACTGGATCACCACTGCAGG + Intergenic
983251617 4:165352085-165352107 AAGAACTGGATCACTGCTGCAGG - Intergenic
983729942 4:170979988-170980010 AGGAGGTGGATAGCCACTGCAGG - Intergenic
984234231 4:177137024-177137046 AAGAACTGGATCACCACTGCAGG + Intergenic
986633932 5:9801542-9801564 AGGAAAGGGATCACCGTTGCAGG + Intergenic
987846751 5:23296432-23296454 AGGAACTGGATCACCCATGCAGG - Intergenic
988421248 5:31008419-31008441 AGGAACTGGATCACTGCTGCAGG - Intergenic
989073246 5:37533987-37534009 GGTAACTGGATCACCACTGCAGG - Intronic
989355520 5:40539648-40539670 AGGAACTGGATGACCACTGCAGG - Intergenic
989431608 5:41361383-41361405 AGAAACTGGATCACTACTGCAGG - Intronic
989562845 5:42871206-42871228 AAGAACTGGATCACTGCTGCAGG - Intronic
990918641 5:60937766-60937788 AGGAAGTGGATTGCCGCTGCAGG - Intronic
993920562 5:93795432-93795454 AGGAACTGGATCACTGCTGCAGG - Intronic
995076396 5:107989917-107989939 ATGAAAAGGACCACCACTGCTGG + Intronic
996197757 5:120631349-120631371 AAGGACTGGATCACCACTGCAGG + Intronic
996495411 5:124149318-124149340 AGGAAGTGGTTTACCACTGCAGG - Intergenic
996875424 5:128235461-128235483 AGGAATTGGATTACCGCTGCAGG - Intergenic
997005064 5:129806655-129806677 AGGAAGTGGATCGCTGCTGCAGG - Intergenic
997231151 5:132243994-132244016 AGGAACTGGATCACTACTGCAGG - Intronic
997613574 5:135231519-135231541 AGGAGCTGCTTCCCCACTGCAGG + Intronic
997798390 5:136834418-136834440 GGGAACTGTATTGCCACTGCAGG - Intergenic
998738782 5:145175488-145175510 AAGAAATGGATCATCACTGAAGG + Intergenic
999127074 5:149253734-149253756 AGGAACTGGAACTCCACACCAGG - Intronic
1003383721 6:5648488-5648510 AGGGAATGGATCCCCAGTGCAGG - Intronic
1004888482 6:20074554-20074576 AGGAACTGGATCACCACTGCAGG + Intergenic
1005222126 6:23598753-23598775 ATGAAGTGGATCACTTCTGCAGG + Intergenic
1007864612 6:44955232-44955254 AGGAGGTGGATCACCACTGCAGG + Intronic
1008042336 6:46815571-46815593 AGGAACTGGATCACAACTGCAGG - Intronic
1008431330 6:51421132-51421154 AGGAACTATATCACCACTGCAGG + Intergenic
1009589085 6:65643044-65643066 AGGAACTGGATTGCTACTGCAGG + Intronic
1011965924 6:93157086-93157108 TGGAACTGGATAACCCCTGCAGG - Intergenic
1012299288 6:97564043-97564065 AGGAACGGGATCACCCTGGCAGG - Intergenic
1014195229 6:118549246-118549268 AGGAAATGGAGTACCACTGGAGG - Intronic
1014196440 6:118565528-118565550 AGGAAGTGAAACACCAATGCAGG - Exonic
1014420339 6:121235726-121235748 AGGAACTGGATCACTGCTGCAGG - Intronic
1014482091 6:121951301-121951323 AGGAACGGAATCACTGCTGCAGG - Intergenic
1016012113 6:139147924-139147946 AGGAACTGCACCACCACTGATGG - Intronic
1016140579 6:140604974-140604996 AGGAACTGAGTCACCACTATTGG + Intergenic
1016508386 6:144811418-144811440 AGGAGCTGAAACACCACTTCAGG - Intronic
1017204066 6:151786179-151786201 ATGCCCTGGATCACAACTGCTGG + Intronic
1017326468 6:153146309-153146331 AGGAACTGGATTACTGTTGCAGG - Intergenic
1019365531 7:630699-630721 AGGCACTGCATCACCAAAGCTGG + Intronic
1019911433 7:4102652-4102674 AGGACCAGGAACACCCCTGCTGG - Intronic
1021979831 7:26043682-26043704 AGGAAGTGGATTACTCCTGCAGG - Intergenic
1023144421 7:37135390-37135412 AGGAACTGGATCACCACCGCAGG + Intronic
1023504259 7:40883861-40883883 CTGAACTGGATCCCCACTGTGGG + Intergenic
1023657655 7:42441246-42441268 AGGAACTGGATCACCACTGAAGG - Intergenic
1023712650 7:43011453-43011475 AGGAACTGGGTCATTACTGGGGG - Intergenic
1024367354 7:48535991-48536013 AGGAACTGGATCACTGCTGCTGG - Intronic
1024455650 7:49604331-49604353 AGGAAGTGGATTGCTACTGCAGG + Intergenic
1024716038 7:52080197-52080219 AGGAACTGGAGCAGAACTGTGGG + Intergenic
1026473387 7:70713187-70713209 AGGTGCTGCATCACCAATGCCGG + Intronic
1026640818 7:72123754-72123776 AGGAAATTGTTCTCCACTGCAGG + Intronic
1026711738 7:72747189-72747211 AGGAACTGAATCACAGGTGCCGG + Intronic
1027127374 7:75566358-75566380 AGGAACAGGACCTCCGCTGCTGG - Intronic
1027691737 7:81354873-81354895 AGGAGCTGCATCGCTACTGCAGG - Intergenic
1027746148 7:82076850-82076872 AGGAGATGAATAACCACTGCTGG - Intronic
1028197695 7:87926578-87926600 AGGAACTGGATCACTGCTGCAGG + Intergenic
1028201214 7:87964092-87964114 AGGATATAGATCACCACTGAAGG - Intronic
1028380230 7:90191950-90191972 AGGAACTGGATGAAGACTGAAGG - Intronic
1028551105 7:92067259-92067281 AGGCACTGGATATCCAATGCTGG - Intronic
1028822517 7:95229277-95229299 AGGAACTGGATCACCGCTGCAGG + Intronic
1030007276 7:105131966-105131988 AGGAACTGGCTCGCAAATGCAGG + Intronic
1030106544 7:105992201-105992223 AGGAGCTGGATCTCCAATTCTGG - Intronic
1030533414 7:110737188-110737210 AGGAACTGGATCACCATGGCAGG + Intronic
1031261317 7:119524814-119524836 TGGAAATGGATCACCACTGCAGG + Intergenic
1031655518 7:124349850-124349872 AGGAACTGGATTGCCGCTGCAGG - Intergenic
1032935647 7:136728916-136728938 AGAAACTGGATTGCCGCTGCAGG + Intergenic
1034265620 7:149779327-149779349 ACTAACTGGTTCACCAATGCTGG - Intergenic
1035078006 7:156193763-156193785 TGGAACTGGATGACTTCTGCTGG - Intergenic
1035591555 8:818489-818511 AGGAACTAGATCAGTGCTGCAGG - Intergenic
1037961678 8:23102724-23102746 AGGCCCTGGGTCACCGCTGCCGG + Exonic
1037969848 8:23164197-23164219 AGGCCCTGGGTCACCGCTGCCGG - Intergenic
1038367111 8:26947837-26947859 AGGAACTAGAACACCAATCCTGG - Intergenic
1039325627 8:36482391-36482413 AGGACCTGCATCACCACTCTTGG - Intergenic
1041129178 8:54678961-54678983 AGCAAATCTATCACCACTGCTGG - Intergenic
1041831989 8:62164641-62164663 AGGAACTGAATCACCGCTGCAGG + Intergenic
1042160629 8:65890684-65890706 AGGAAATGGATCACCACTGTAGG + Intergenic
1042431342 8:68710249-68710271 AGGAAATGGATCACCGCTGCAGG + Intronic
1042645588 8:70982666-70982688 AGGAACTGGATCACCACTGCAGG - Intergenic
1043205880 8:77438477-77438499 AGGAACTGGATTGCTCCTGCAGG - Intergenic
1043545063 8:81306345-81306367 AGGTACTGGATCACTACTGCAGG + Intergenic
1043556814 8:81439575-81439597 AGGAACTGGATCACCACTGCAGG - Intergenic
1043876485 8:85491985-85492007 AGGAACTGGATCACTGCTGCAGG - Intergenic
1043987761 8:86714659-86714681 AGGAACTAGATCACTGCTGCAGG + Intronic
1044569802 8:93704508-93704530 AGGAACTGGGCCAGCACAGCAGG - Intronic
1044903283 8:96972015-96972037 AGGAACTGGATCACCACTGCAGG + Intronic
1044947962 8:97408389-97408411 AGGAACTGGATCACCACTGCAGG - Intergenic
1045814333 8:106261801-106261823 AGGAACTGGATCACTGCTGCAGG - Intergenic
1047607399 8:126488705-126488727 AGGAACTGAATCACTGCTGTAGG - Intergenic
1047890487 8:129303227-129303249 AGGACCTGGATCACTGCTGCAGG - Intergenic
1047901989 8:129432481-129432503 AGGAAGTGGCTTGCCACTGCAGG - Intergenic
1047976144 8:130132653-130132675 AGGAACTGCATCTCTACTGCAGG - Intronic
1049427175 8:142542698-142542720 AGCAGCTGGGTCACCCCTGCTGG + Intronic
1050400402 9:5247764-5247786 AGGAACTGGATCACACCTGCAGG + Intergenic
1050903406 9:10974446-10974468 AGGAATTGGATTGCCTCTGCAGG + Intergenic
1051053448 9:12956461-12956483 AGGAAGTGGCTTGCCACTGCAGG - Intergenic
1055156276 9:73066717-73066739 AGGAACTGGATCACTGCTGGAGG + Intronic
1055911996 9:81363924-81363946 AGGAACTGGATCACCCCTGCAGG + Intergenic
1058233530 9:102461368-102461390 AGGACCTGGATCATCCCAGCAGG + Intergenic
1060314562 9:122497175-122497197 AGGAACTGGATCACTGCTGCAGG - Intergenic
1062579951 9:137225054-137225076 AGCAACTGGAGCACGACAGCTGG - Exonic
1186308346 X:8289740-8289762 AGGAACTGGATCACTACTGCAGG + Intergenic
1187588791 X:20693186-20693208 AGGAACTGGATCACCACTGCAGG + Intergenic
1187752248 X:22479159-22479181 AGGAACTGGATCATTGCGGCAGG - Intergenic
1188389413 X:29601049-29601071 AGGAACCCGATCACTGCTGCAGG - Intronic
1189567140 X:42254764-42254786 AGGAACTGGATCGCCACTGCAGG + Intergenic
1189946114 X:46180530-46180552 AGGAAATGGATCACAGCTGCAGG - Intergenic
1191223301 X:58014538-58014560 AAAAACTGAATCACCACTGCAGG - Intergenic
1191813576 X:65218327-65218349 AGGAAGTGGATTGCCACTGCAGG + Intergenic
1191909345 X:66131260-66131282 AGGAACTGGATCACTGTTGCAGG - Intergenic
1191917328 X:66216620-66216642 AGGAATTGGAACACCAATTCTGG + Intronic
1192609567 X:72554338-72554360 AGGAACTGGATCACTGCTGCAGG + Intronic
1192853049 X:74977846-74977868 AGAAACTGGATTGCCGCTGCAGG - Intergenic
1192981935 X:76353542-76353564 AGAAACTGGATCACTGCTGCAGG + Intergenic
1192991867 X:76467838-76467860 AGGAGGTGGATTGCCACTGCAGG - Intergenic
1193366312 X:80637958-80637980 AGGAACTGGATCACTGCTGCAGG + Intergenic
1194231525 X:91331099-91331121 AGAAACTGGATCATGGCTGCAGG + Intergenic
1194380871 X:93190543-93190565 AGGAACTGGATAGCCACGGCAGG + Intergenic
1195237034 X:102910991-102911013 AGAAACTGGATCACTGTTGCAGG + Intergenic
1195972890 X:110492316-110492338 AAGGACAGGATCACCGCTGCAGG - Intergenic
1196023958 X:111020664-111020686 AGGAACTGGATCACCACTGCAGG + Intronic
1196231947 X:113233957-113233979 AGGAACTGGATCACTGCTGTAGG - Intergenic
1196711656 X:118769796-118769818 ATGACCTGGAGCACCACAGCCGG + Intronic
1196948952 X:120856996-120857018 AGGAACTGGATCAATGCTGCAGG + Intergenic
1197034711 X:121859659-121859681 AGGACCTGGATAACCCTTGCAGG - Intergenic
1197081812 X:122426770-122426792 AGGAACTGGGTCACCCCTGCAGG - Intergenic
1197515571 X:127423287-127423309 AGGAACTGGATCAACCCTACAGG - Intergenic
1198567057 X:137915725-137915747 AGGAACTGCATCCACACTTCTGG + Intergenic
1198604605 X:138322782-138322804 AGGATCTGGATCACTGCTGCAGG - Intergenic
1198664686 X:139007813-139007835 AGGAACTGGATCACCACTGCAGG + Intronic
1198943387 X:141982953-141982975 AGGAAGTGGCTTCCCACTGCAGG - Intergenic
1199015010 X:142804743-142804765 AGAAACTGGATTGCCACTGCAGG - Intergenic
1199121540 X:144060636-144060658 AGGAACTGGATCCATGCTGCAGG + Intergenic
1199499880 X:148497807-148497829 AGCAACTGGATCCCCACCACAGG + Intergenic