ID: 937699493

View in Genome Browser
Species Human (GRCh38)
Location 2:124847607-124847629
Sequence CACAGACCCTTTGAAGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1075
Summary {0: 47, 1: 97, 2: 297, 3: 298, 4: 336}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937699493_937699497 -3 Left 937699493 2:124847607-124847629 CCAGTTCCTTCAAAGGGTCTGTG 0: 47
1: 97
2: 297
3: 298
4: 336
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699493_937699498 10 Left 937699493 2:124847607-124847629 CCAGTTCCTTCAAAGGGTCTGTG 0: 47
1: 97
2: 297
3: 298
4: 336
Right 937699498 2:124847640-124847662 GCTTTCCTGGTACGTTCCTGTGG No data
937699493_937699500 20 Left 937699493 2:124847607-124847629 CCAGTTCCTTCAAAGGGTCTGTG 0: 47
1: 97
2: 297
3: 298
4: 336
Right 937699500 2:124847650-124847672 TACGTTCCTGTGGTAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937699493 Original CRISPR CACAGACCCTTTGAAGGAAC TGG (reversed) Intronic
901139448 1:7018987-7019009 CACAGAACCAGGGAAGGAACAGG - Intronic
903655330 1:24945739-24945761 CACATACCCTGAAAAGGAACCGG - Intronic
904776671 1:32913071-32913093 CACAGACCCTCTCAAGGTCCTGG - Intergenic
905203144 1:36327254-36327276 CATACACCCCTTGAAGAAACAGG - Intronic
905497292 1:38402878-38402900 CACAGACCCTTTGAAGGAAGTGG + Intergenic
906754009 1:48291737-48291759 CACAGACCCTTTGAAGGAAGTGG - Intergenic
906860203 1:49351038-49351060 CACAGACCCTTTGAAAGAAGCGG - Intronic
907145793 1:52230174-52230196 CACAGACACTTTGAAGGGTGAGG + Intronic
908660779 1:66432635-66432657 CACGGACCCTTTGAAGGAAGTGG - Intergenic
908803704 1:67907823-67907845 CACAGACCCTCTGAAGGAAACGG - Intergenic
908820203 1:68078154-68078176 CACAGACCCTTTGAAGGAAGTGG - Intergenic
908883269 1:68758234-68758256 CACAGACCCTTTGAAAAATGTGG + Intergenic
908981620 1:69966590-69966612 CACAGACTCTCTGAAGGAAGCGG + Intronic
909713213 1:78675010-78675032 CACAGACCCTTTGAAAGAAGTGG - Intergenic
909724125 1:78813146-78813168 CACAGACTCTTTTAAACAACTGG + Intergenic
909828396 1:80154454-80154476 CACAGACCCTTTGAAGGAGGTGG - Intergenic
909860043 1:80593764-80593786 CACAGATACTTTGAAGGAAGTGG + Intergenic
910142279 1:84038774-84038796 CACAGACCCTCTGAAGGAAGTGG - Intergenic
911063587 1:93768513-93768535 CACCCACCCTTTGAAGGAGGGGG + Intronic
911265940 1:95743162-95743184 CACAGACCCTTTGAAAGAACTGG - Intergenic
911561972 1:99417691-99417713 CACAGAGCCTTTAAAGGAACTGG + Intergenic
911806242 1:102211467-102211489 CAATGACCCTTTAAAGGAACTGG - Intergenic
912033169 1:105274942-105274964 CACAGACCCTTTAAAGGAACTGG - Intergenic
912181133 1:107220312-107220334 CACAGACCCTTTGAAGGTGGTGG - Intronic
912554730 1:110507970-110507992 CAAAGCCCCTTTGAAGTAAGAGG - Intergenic
913336640 1:117715259-117715281 CACAGACCCTTTGAAGAGAGTGG + Intergenic
913339868 1:117747732-117747754 CACACACCCTCTGAAGGAAGTGG - Intergenic
913463627 1:119116495-119116517 CACAGACCCTTTGAAAGAAGTGG + Intronic
914927030 1:151897702-151897724 CACAGACCCTCTGAAGGAAGCGG + Intronic
914967834 1:152277277-152277299 CACAGACCCTCTGAAGGAAGTGG + Intergenic
916263595 1:162868495-162868517 CACAGACCCTCTGGAGGAAGTGG + Intronic
916331735 1:163625144-163625166 CACAGACCCTTTGAAGGAGATGG - Intergenic
916579786 1:166096977-166096999 CACAGACCCTCTGAAGGAAGCGG + Intronic
917058021 1:171004631-171004653 CACAGACCCTCTGAAGGAAGTGG - Intronic
917079968 1:171247618-171247640 CACAGGACCTTTGAAAGAAGTGG - Intergenic
917317551 1:173741182-173741204 CACAGATCCTTTGATAGAAGTGG - Intronic
917318845 1:173758485-173758507 CACAGACCCTCTGAAGAAAGCGG + Intronic
917461454 1:175234197-175234219 CACAGACCCTCTGAAGGAAGCGG + Intergenic
917913714 1:179678399-179678421 CACAGACCCTTTGAAGAAACTGG - Intronic
918154869 1:181835323-181835345 CACAGACCCTTTAAAGGAAGTGG + Intergenic
918158225 1:181872022-181872044 CAAAGACCCTCTGAAGGAAGTGG + Intergenic
918819798 1:189237401-189237423 CATATACAGTTTGAAGGAACTGG - Intergenic
919520637 1:198583099-198583121 CACGGACGCTTTGTAGGAAATGG - Intergenic
919549545 1:198966835-198966857 CACAGACCCTCTGAAGGAAGCGG - Intergenic
919598472 1:199593517-199593539 CACAGACCCTCTGAAGGAAGCGG + Intergenic
920799884 1:209176706-209176728 CACAGACCCTTTGAAGGAACTGG + Intergenic
921116831 1:212099735-212099757 AACAGATCCTTTGAAAGAAGTGG - Intronic
921399705 1:214707773-214707795 CACAAACCCGTTGAAGGAACTGG - Intergenic
921409947 1:214824247-214824269 CACAGACCCTCTGAAGGAAGCGG - Intergenic
921762929 1:218937620-218937642 CACAGACCCTTTGAAGGAGGTGG - Intergenic
921842784 1:219846425-219846447 CATGGATCCTTTGAAGGAAGCGG + Intronic
922396189 1:225203080-225203102 CACAGACCCTCTAAAGAAAGTGG - Intronic
922657770 1:227401258-227401280 CACAGACCCTCTGAAGGAAGTGG + Intergenic
922673541 1:227533113-227533135 CACAGACCCTCTGAAGGAAGTGG - Intergenic
923446214 1:234073600-234073622 CCCAGTACCTTTGAAGGAACCGG - Intronic
923458565 1:234187522-234187544 CACAGACCCTTTGAAGGAAGCGG + Intronic
923648078 1:235845096-235845118 CACAGACCCTCTGAAGGAAGCGG + Intronic
923661665 1:235962468-235962490 CACAGACCCAATGAAGGAAGCGG + Intergenic
923691902 1:236202446-236202468 CACAGACACTTGGAAAGAAGCGG - Intronic
923808802 1:237289182-237289204 CACAGAGCCTCTGAAGGAAGCGG - Intronic
924063598 1:240201787-240201809 GTCAGACCTTTTGCAGGAACTGG + Intronic
924321544 1:242855524-242855546 CACAGACACTATGAAGGAAGTGG - Intergenic
924609732 1:245563805-245563827 CCCAGACCCTCTGAAGGAAGCGG + Intronic
924878096 1:248128004-248128026 CACAGACCCTTTGAAGGAACTGG - Intergenic
924880228 1:248152802-248152824 CAGAGACCCTTTGAAGGAACTGG - Intergenic
924883341 1:248187226-248187248 CACAGATCCTTTGAAGGAACTGG - Intergenic
924885418 1:248210332-248210354 CACAGATCCTTTGAAGGAACTGG - Intergenic
924894168 1:248317702-248317724 CACAGACCCTTTGAAGGAACTGG + Intergenic
924909747 1:248497537-248497559 CAAAGACCCTTTGAAGGAGGTGG - Intergenic
924914355 1:248550523-248550545 CAAAGACCCTTTGAAGGAGGTGG + Intergenic
1063335010 10:5203616-5203638 CACAGACCCTTTGAAAGAAGTGG - Intronic
1063561362 10:7130863-7130885 CACAGACCCCCTGAAGGAACTGG - Intergenic
1064557262 10:16559729-16559751 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1064868060 10:19904628-19904650 CTCAGACCCTTTGAAGGAACTGG - Intronic
1065462296 10:25981889-25981911 CTGAGACATTTTGAAGGAACTGG + Intronic
1065571054 10:27071668-27071690 CAGAGACCCTGTGAAAGAACAGG + Intronic
1065894639 10:30152456-30152478 CAAATACCATTTGAAGGAACTGG - Intergenic
1067034497 10:42903074-42903096 CACAGACCCCTTGAAGGAGGTGG + Intergenic
1067234185 10:44434713-44434735 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1068096756 10:52500149-52500171 TACAGACCCTCTGAAGGAAGTGG - Intergenic
1068114637 10:52723889-52723911 CACATACCCTTTGAAGGAGGTGG + Intergenic
1068122823 10:52801292-52801314 TAAAGACCCTTTGAAGGAAGTGG - Intergenic
1068173287 10:53422938-53422960 CGCAGACCCTTTGAAGGAAGTGG - Intergenic
1068571168 10:58630730-58630752 CATAAACCCTTTGAAGAAAAGGG - Intronic
1068808484 10:61227870-61227892 CACAGACCCTTTGAAAAAGGTGG + Intergenic
1069129629 10:64682449-64682471 TACAGACCCTTTGAATGAAATGG - Intergenic
1069146454 10:64897303-64897325 CATAGACTCTTTGAAAGAAGTGG - Intergenic
1069160073 10:65082927-65082949 AACAGATACTTTGAAGGAAGTGG + Intergenic
1069325142 10:67224476-67224498 CACAGACCCTTTGAAGGAAGCGG + Intronic
1069646391 10:70001550-70001572 CATGGACCCTTTGAATGATCTGG - Intergenic
1070216006 10:74381760-74381782 CACATACACCTTGAAGGAAGGGG + Intronic
1071015915 10:80997091-80997113 CACAGACCCTTTGCAGGAGGTGG - Intergenic
1071024311 10:81093605-81093627 TACAGACCCTCTGAAGAAAGTGG - Intergenic
1071062641 10:81590981-81591003 AACAGATTCTTTGAAAGAACTGG + Intergenic
1071843569 10:89498697-89498719 CACAGACCCTCTGAAGGAGGTGG + Intronic
1071932265 10:90485309-90485331 CACAGACCCTTTGAAGGAAGCGG - Intergenic
1072769627 10:98126629-98126651 CACAGACCCTTTGAAGGAACTGG - Intergenic
1072814934 10:98498213-98498235 CACAGACCCTCTGAAGGAAGTGG + Intronic
1072871534 10:99125577-99125599 CACTGATCCTTTGAAAGAAGTGG + Intronic
1072885077 10:99265746-99265768 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1073756188 10:106583416-106583438 CACAGACCCTTTGCAGAACTAGG + Intronic
1074467119 10:113692974-113692996 CACAGAGCCTTTGAAAGAAGTGG - Intronic
1074807900 10:117072430-117072452 CACACACCCTCTGAAAGAAGTGG + Intronic
1075581081 10:123618988-123619010 CACATACTTTTTGAAGGAAGAGG + Intergenic
1076006324 10:126950533-126950555 CACTGTCCCTTTGAAGCAAAGGG + Intronic
1076112655 10:127872721-127872743 CATAGTCCCTTTGAAAGAAGTGG - Intergenic
1077834323 11:5910944-5910966 CACAGACCCTTTGAAGGAACTGG - Intronic
1077853128 11:6095395-6095417 CACAGACCCTCTGAAAGAAGTGG + Intergenic
1078706579 11:13749436-13749458 CACAGACCCCCTAAAGGAAGCGG + Intergenic
1079890578 11:26047964-26047986 CAAGGACACTTTGAAGAAACAGG - Intergenic
1079974808 11:27077463-27077485 CACAGGCCCTTTGAAAGAAGTGG - Intronic
1080153166 11:29076953-29076975 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1080324002 11:31049616-31049638 CGCAGACCCTCTGAAGGAAGTGG + Intronic
1080586016 11:33683207-33683229 CATAGACGCTCTGAAGGAAGTGG - Intergenic
1080672693 11:34395470-34395492 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1080864068 11:36177999-36178021 CACAGAATCTTTGAAGGAAGTGG - Intronic
1080977803 11:37363788-37363810 CACAGACTCTTTGAAAGGAAGGG + Intergenic
1081091185 11:38867756-38867778 CACAGACCCTTTGAAGGAACTGG - Intergenic
1081122272 11:39282318-39282340 TACAGACCCTTTCAAGGGGCTGG - Intergenic
1081195130 11:40152064-40152086 CACAGACCCTCTGAAGGAAATGG + Intronic
1081326814 11:41754828-41754850 CACAGACCCTTTGAAGAAACTGG - Intergenic
1082120918 11:48378784-48378806 CACAGATGCTTTGAAGGAATTGG - Intergenic
1082654726 11:55839745-55839767 CACAGTCCATTTGAAAAAACAGG - Intergenic
1082723187 11:56704796-56704818 CACAGGCCCTTTGAAGGAAGTGG + Intergenic
1082903773 11:58284709-58284731 CACAGATCCTCTGAAGGAAGTGG + Intergenic
1082916723 11:58445911-58445933 CACAGACCCTCTGAAAGAAGTGG + Intergenic
1082941099 11:58706470-58706492 CACAGACCATTTGAAGAAACTGG + Intronic
1083072730 11:60003305-60003327 CACAGGCCCTCTGAAGGAAGTGG + Intergenic
1083317631 11:61826394-61826416 CACAGAGGCTTTGAAGGTTCAGG - Intronic
1083685253 11:64371497-64371519 CACAGCCCCTATGAGGGAAGGGG - Exonic
1084583005 11:70036162-70036184 CACACTCCCTTGGAAGGATCTGG + Intergenic
1084595410 11:70113862-70113884 CACAGCCCCTTTGGAGGAGCTGG + Intronic
1085240688 11:75051386-75051408 TACAGAGCCTTTGAAGGAACTGG - Intergenic
1086082853 11:82923113-82923135 CACAGACCCTCTGAAGGAAGTGG - Intronic
1086264641 11:84983207-84983229 CACAGGCCCTCTGAAGGAAGCGG + Intronic
1086297560 11:85387943-85387965 CACAGACCATTTGAAGGAGGTGG + Intronic
1086743021 11:90391424-90391446 CACAGACTTTTTGAAAGAAGTGG + Intergenic
1086825558 11:91490576-91490598 CACAAACCCTCTGAAGGAATTGG - Intergenic
1086869515 11:92019416-92019438 TACAGACCCTTTGAAAGGAGTGG - Intergenic
1087602022 11:100328925-100328947 CACAGTCCCTTTGAAGGAACTGG + Intronic
1087609933 11:100422313-100422335 CACAGGCCCTTTGAAGGAGGTGG + Intergenic
1087615813 11:100486037-100486059 CACAGACCCTCTGAAGGAAATGG + Intergenic
1087630685 11:100647372-100647394 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1087692333 11:101335883-101335905 AACTAATCCTTTGAAGGAACAGG - Intergenic
1087804276 11:102539001-102539023 CACAGACCCTTTGAAGGAACTGG + Intergenic
1087817617 11:102676547-102676569 CACAGACCCTTTGAAGGGACTGG - Intergenic
1087866201 11:103229225-103229247 CACAGACCCTTTGAAGGAACTGG - Intronic
1088176068 11:107054275-107054297 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1088239389 11:107758305-107758327 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1088372509 11:109106971-109106993 CACAGACCCTCTAAAGGAACTGG - Intergenic
1088388172 11:109282305-109282327 CACAGACCCTTTGAAGGAAGCGG - Intergenic
1088799901 11:113296261-113296283 CACAGATCTTTTGAAAGAAGCGG + Intergenic
1088951186 11:114571797-114571819 CATAGACCCTTTGAAGGAACAGG + Intronic
1089107258 11:116023405-116023427 CACAGACCCTCTAAAGGAAGCGG + Intergenic
1089836893 11:121378808-121378830 CACAGACCCTTTAAAGAAACCGG + Intergenic
1090103942 11:123831438-123831460 CACAGATTCTTTGAAGGAGGTGG + Intergenic
1090664705 11:128906745-128906767 CACAAGCCCTTTGAAGGGATTGG - Intronic
1090895138 11:130965089-130965111 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1091210661 11:133855189-133855211 CACAGACCCTCTGAAGCAAGTGG - Intergenic
1091440392 12:508214-508236 CAGAGACACCTTGAAGGATCTGG - Intronic
1093277473 12:17148121-17148143 CACAGACCCTTTGAAGAAAGTGG + Intergenic
1093469307 12:19483463-19483485 CACAGATCCTTTCAAAGAAGCGG - Intronic
1093488885 12:19682053-19682075 TACAGACCCTCTGAAGGAAGCGG - Intronic
1093497595 12:19775749-19775771 CACAGGCCCTCTAAAGGAAGCGG - Intergenic
1093524606 12:20092322-20092344 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1093758253 12:22876515-22876537 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1093963695 12:25303171-25303193 CACAGATCCTTTAAAGGAGGTGG + Intergenic
1093994824 12:25630431-25630453 CACAGACCCTCTAAAGGAAGTGG + Intronic
1094263599 12:28528506-28528528 CACAGACCCTCTGAAGGAAGTGG - Intronic
1094718440 12:33035381-33035403 CACAGACCCTCTGAAGGAAATGG - Intergenic
1094801916 12:34047648-34047670 CACAGACCCTCTAAAGGAAGTGG + Intergenic
1095115046 12:38343553-38343575 CACAGACCCTCTGAAGGAAGCGG + Intergenic
1095176243 12:39095564-39095586 CACAGAACTTTTGAAGGAGGTGG + Intergenic
1095178763 12:39123067-39123089 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1095225677 12:39674504-39674526 CAAAGACCCTTTGAAAGATGTGG + Intronic
1095777462 12:46025276-46025298 CACAGACTCTTTGAAAGAAGTGG - Intergenic
1095931940 12:47636455-47636477 CACAGACCCTCTGAAGGAAGCGG + Intergenic
1096275765 12:50206724-50206746 CACTGAGTCTTTGAAGGAACAGG - Intronic
1097537418 12:60889527-60889549 CGCAGACCCTTTGGAGGAGGTGG - Intergenic
1097607023 12:61768442-61768464 CACAGACCCTTTGAAAAAAGTGG + Intronic
1098163276 12:67668022-67668044 CACAGACCATTTGGAGGAGCTGG + Intergenic
1098317094 12:69204264-69204286 CACTGACCCTATGAAGGAGAAGG + Intergenic
1098500481 12:71186807-71186829 CACAGGCCCTCTGAAGGAAGTGG + Intronic
1098852268 12:75611069-75611091 CACAGACCCTTTGAAGGAGCTGG + Intergenic
1098910519 12:76204114-76204136 CACAGACCCTCTGAAGGAAGCGG + Intergenic
1098961056 12:76739865-76739887 CACAGACCTTCTGAAGGAAGCGG - Intergenic
1099041930 12:77667258-77667280 CACAGACCCTTTGAAGGAACTGG + Intergenic
1099392914 12:82102559-82102581 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1099473171 12:83075252-83075274 CACAGACCCTTTGAAGGAAGTGG - Intronic
1099477326 12:83122700-83122722 CACATACCCTCTGAAGGAAGGGG - Intronic
1099566319 12:84252044-84252066 CACAGTCAGTATGAAGGAACAGG + Intergenic
1099702778 12:86108856-86108878 GACAGACACTTTGAAGGAGCAGG - Intronic
1100203724 12:92326129-92326151 CACAGACCCCCTGAAGGAAGCGG - Intergenic
1100291125 12:93215619-93215641 CACAGACCCTCTGAAAGAAGTGG - Intergenic
1100669633 12:96796161-96796183 CACTGACCCTCTGAAGGAAGTGG - Intronic
1100951215 12:99852713-99852735 CACAGACCCTTTGAAGAAGGTGG + Intronic
1100966787 12:100021873-100021895 CACAGACTCTTTGAAGGAAGCGG + Intergenic
1101290254 12:103361137-103361159 CACAGACCCTATGAAGAAAGTGG + Intronic
1101544498 12:105698462-105698484 CACAGACCTTTTGAAGGAACTGG - Intergenic
1101635413 12:106536153-106536175 CACAGACCCTCTGAAAAAAGCGG - Intronic
1102916882 12:116760716-116760738 CACAGACTCTCTGAAGGAAACGG - Intronic
1103458731 12:121087337-121087359 TGAAGACCCTTTGAAGGATCAGG + Intergenic
1103608304 12:122104924-122104946 CTCTGACCTTTTGAAGGGACTGG + Intronic
1103734397 12:123050035-123050057 CACAGACGCTGTCAAGAAACAGG - Intronic
1103761256 12:123251714-123251736 CACAGACCCTCTGAAGGAAGCGG - Intronic
1104198027 12:126560158-126560180 CATAGAACATTTGAAGGAAAGGG + Intergenic
1104741143 12:131175758-131175780 CACAGACCCTTTGAAAGAACTGG + Intergenic
1105990547 13:25615919-25615941 CACAGACCCTTGGAAGAGAGTGG - Intronic
1106378380 13:29211822-29211844 CACAGACCCTTTGAAAGAGGTGG - Intronic
1106392376 13:29347037-29347059 CACGGACCCTTTGAAAGAGGTGG - Intronic
1106978264 13:35247662-35247684 CACAGACCCTTTGAAGGAAGTGG - Intronic
1107666367 13:42694521-42694543 CAAAGACCCTCTGAAGGAAGTGG - Intergenic
1107756134 13:43623608-43623630 CACACACCCTCTGAAGGAAGTGG - Intronic
1108134169 13:47337922-47337944 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1108188830 13:47916763-47916785 CACAGACCCTTTAAAGGAAGTGG + Intergenic
1108469920 13:50757099-50757121 CACAGACCCTCTGAAAGAAGCGG - Intronic
1108831610 13:54486682-54486704 CACAGACCCTTTGAAGAAACTGG + Intergenic
1108901260 13:55411072-55411094 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1109048066 13:57438356-57438378 CACAGGCCCTCTGAAGGAAGTGG - Intergenic
1109150603 13:58843231-58843253 CACAGATCCTTTGAAGGAAATGG + Intergenic
1109213704 13:59563754-59563776 CACAGACCCTCTTAAGGAAGCGG - Intergenic
1109484531 13:63001703-63001725 CACAGACCCTCAGAAGGAGGTGG + Intergenic
1109508532 13:63337552-63337574 CATAGACCCTGCGAAGGAAGTGG - Intergenic
1109624873 13:64962041-64962063 AACAGACGCTTTGAAAGAAGTGG + Intergenic
1109924531 13:69119517-69119539 CACAGATCCTTTGAAAGAAGTGG + Intergenic
1109945171 13:69423367-69423389 CACAGGCCCTTTGAAGGAAGTGG + Intergenic
1109975575 13:69828146-69828168 CACAGACCCTTTGAAAGAAGTGG + Intronic
1110150944 13:72252265-72252287 ATCAGACACTTTGAAGTAACTGG - Intergenic
1110158175 13:72343086-72343108 CACAGACCCTTTGAAAGAGGTGG - Intergenic
1110181740 13:72625788-72625810 CACAGACCCTTTGAAGGAACTGG + Intergenic
1110204396 13:72895791-72895813 CACAGACCCTCTGAAGGAAGCGG + Intronic
1110209501 13:72954749-72954771 CACAGATCCTTTAAAAGAAGTGG - Intronic
1110376037 13:74794646-74794668 CACAGATCTTTTGAAGGAAATGG - Intergenic
1110504681 13:76271922-76271944 CACAAACCCTTTGAAGGAAGTGG + Intergenic
1110852764 13:80263366-80263388 CACAGACCTTTTGAAGGAAGTGG - Intergenic
1111225472 13:85266009-85266031 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1111988437 13:95090045-95090067 CACAGACCCTTTGAAGGAAGTGG + Intronic
1112035513 13:95493050-95493072 CGCAGACCCTCTGAAGGAAGCGG - Intronic
1112747386 13:102541913-102541935 CACAGACCCTCTGAAGGACCCGG + Intergenic
1113006198 13:105705184-105705206 TACTCACCCTTTGAAGGAGCAGG + Intergenic
1113270062 13:108663130-108663152 CACAGATCCTCTGAAAGAAGAGG - Intronic
1113329812 13:109317222-109317244 CACAGACCCTCTCAAGGCAGTGG + Intergenic
1113415771 13:110127304-110127326 CACAGACCCCTGGAAGGACATGG + Intergenic
1113535013 13:111059052-111059074 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1113638278 13:111937242-111937264 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1114329131 14:21618271-21618293 CACAGACCTTTTGGAGGAAGTGG - Intergenic
1114697702 14:24643304-24643326 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1115393283 14:32877721-32877743 CACAGACCCTTTGAAGGAAATGG - Intergenic
1115938197 14:38578623-38578645 CGCAGACCCTTTGAAGGAACTGG - Intergenic
1115958397 14:38808380-38808402 CACAGATCCTCTTAAGGAAGTGG + Intergenic
1116049167 14:39781893-39781915 TACAGACCCTCTGAAGGAAGAGG - Intergenic
1116063849 14:39958066-39958088 TACAGACCCTCTGAAGAGACTGG + Intergenic
1116346576 14:43802556-43802578 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1116806698 14:49501056-49501078 CACAGACCCTCTGAAATAAGGGG + Intergenic
1117103836 14:52378670-52378692 CAAAGACCCTTTGAAGGAACTGG - Intergenic
1117615280 14:57528086-57528108 CACAGACCCTTTGAAAAAAGTGG - Intergenic
1118140253 14:63072600-63072622 CACAGTCCCTTTGAGGGAGGTGG - Intronic
1118162171 14:63301685-63301707 AACAGACCCTCTGAATGAAGCGG + Intergenic
1118486937 14:66223370-66223392 CACAGACACTTTGAAGGGTGAGG + Intergenic
1118532317 14:66719514-66719536 CACAGACCCTCTGAAGAAAGAGG - Intronic
1119841313 14:77795211-77795233 CACAGACCCTTTACAGGAGTTGG + Intergenic
1120545736 14:85809102-85809124 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1120736419 14:88057850-88057872 TACAGACCCTTTGAAGAAACTGG - Intergenic
1121309200 14:92925925-92925947 CACAGCACCTTTGCAGGCACAGG + Intronic
1121459717 14:94065616-94065638 CACAGACCCTCTGAAGGAACTGG + Intronic
1121516747 14:94557107-94557129 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1121680899 14:95791969-95791991 GATAGACCCTTGGAAGGAGCTGG + Intergenic
1121725950 14:96149797-96149819 CACAGATCCTTTGAAAGAAGCGG - Intergenic
1121848492 14:97196764-97196786 CACAGACCCTTTGAAGGAGCTGG - Intergenic
1121931959 14:97980256-97980278 CACAGACGCATTGAAGGAAACGG + Intergenic
1122983520 14:105202052-105202074 CACGGCCCCTTTGAAGGGCCTGG + Intergenic
1123700134 15:22908256-22908278 CAAAGACCCTCTGAAGGAAGCGG + Intronic
1124504961 15:30264703-30264725 CACAGACCCTTTGAAGGAACTGG + Intergenic
1124738591 15:32273932-32273954 CACAGACCCTTTGAAGGAACTGG - Intergenic
1125269532 15:37922350-37922372 CTGAGACCCTCTGAAGGAAGTGG - Intronic
1125273329 15:37964423-37964445 TACAGATCCTCTGAAGGAAGTGG - Intronic
1126184881 15:45822034-45822056 CAAAGACTCTTCGAAGGAACTGG - Intergenic
1126190196 15:45871116-45871138 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1126577361 15:50210254-50210276 CACAGACCCTCTGAAAGAAGTGG + Intronic
1126977257 15:54197822-54197844 CACAGACCCTCTGAAGGAACTGG + Intronic
1127031011 15:54863195-54863217 CACAGACCCTCTGAAGGCAGTGG + Intergenic
1127089855 15:55456623-55456645 CACAGACCCTTTGAAAGAAGTGG + Intronic
1127295414 15:57604675-57604697 AATAGGCCCTTTGAAGCAACTGG - Intronic
1129562884 15:76590058-76590080 CACAGACCCTCTGAAGGAAGTGG - Intronic
1129631618 15:77266827-77266849 CACAGACCCTTTGAAGGAGCTGG + Intronic
1130225045 15:82050348-82050370 CACAGACCCTTCCAAGGCCCTGG + Intergenic
1130749701 15:86697960-86697982 CATAGACTCTTTGAAGGAAGTGG - Intronic
1130982920 15:88825169-88825191 CACAGGCCCTGGGAAGGAGCTGG + Intronic
1131456782 15:92587934-92587956 CACAGCTCCGTAGAAGGAACAGG + Intergenic
1131711443 15:95060224-95060246 CACAAACCCTTTGAAAGAAGAGG - Intergenic
1132412846 15:101597658-101597680 CACAGACCCTTTGAAGGAGATGG - Intergenic
1133714964 16:8439170-8439192 TACAGACCCTCTGAGGGAAGTGG - Intergenic
1134222288 16:12364357-12364379 CTAAGACACTTTTAAGGAACAGG + Intronic
1134438547 16:14283631-14283653 CACAGACCCTGTCAGGGCACAGG + Intergenic
1134805904 16:17125206-17125228 CATAGAGCCTTTGAAGGAGGTGG - Intronic
1136932204 16:34429167-34429189 CACATACCCTCTGAAGGAAGTGG + Intergenic
1136972368 16:34982647-34982669 CACATACCCTCTGAAGGAAGTGG - Intergenic
1138798114 16:59993926-59993948 CACGGACCCTCTGAAGGAAGCGG - Intergenic
1139170988 16:64628676-64628698 CACAGAGACTTTGAAAGAAGTGG - Intergenic
1139739088 16:69019545-69019567 CTCAGTCCCTTGGAAGGAAGAGG - Intronic
1140619757 16:76716243-76716265 CACAGGCCCTCTGAAGGAAGTGG + Intergenic
1141103210 16:81212912-81212934 CAAAGACCCTTTGAAGATTCAGG - Intergenic
1141398724 16:83727775-83727797 GACAGATCCCTTGACGGAACTGG + Intronic
1141420325 16:83910883-83910905 CACAGACCCTGTTAAGAATCTGG + Intronic
1142841180 17:2631722-2631744 CACAGACCCTCTGAAGGAAGCGG - Intronic
1144278474 17:13699907-13699929 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1144494511 17:15737841-15737863 CTGAGACCCTCTGAAGGAACTGG - Intronic
1144783180 17:17817899-17817921 CACAGAATCTCTGAAGGATCTGG - Exonic
1144905752 17:18638835-18638857 CTGAGACCCTCTGAAGGAACTGG + Intronic
1146583273 17:34059114-34059136 CACAGACCCTCTGAAGGAAGTGG + Intronic
1147463250 17:40589406-40589428 CACAAACCCTCTGAAGGAAGCGG - Intergenic
1149089485 17:52761662-52761684 TACAGGCCCTTTGAAAGAAGTGG + Intergenic
1149122387 17:53185111-53185133 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1149221285 17:54417940-54417962 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1149516114 17:57282227-57282249 CACAGAGGCTTTGAAAGGACTGG + Intronic
1150205958 17:63407684-63407706 TATAGACCCTTTGAGGGCACAGG - Intronic
1150528602 17:65953449-65953471 CACAGACCCTTTGAAAGAACTGG + Intronic
1150538813 17:66075816-66075838 CCCAGACCCTCTGAAGGAAGAGG + Intronic
1150893539 17:69183477-69183499 CACAGATCCTTTGAAAGAGGCGG + Intronic
1153069616 18:1089935-1089957 CACAGACCCTCTGAAGGAATCGG - Intergenic
1153127198 18:1808652-1808674 CGCAGACACTTTGAAGGATGAGG - Intergenic
1153400342 18:4678371-4678393 CACAGACCCTCTGAAGGAAATGG + Intergenic
1153869371 18:9303065-9303087 CACAGACCTTCTGAAGGAAGTGG + Intergenic
1154089955 18:11349118-11349140 TACAGACCCTTTGAAGGAAATGG + Intergenic
1154297736 18:13165265-13165287 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1156011512 18:32502065-32502087 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1156607181 18:38680135-38680157 CATAGACCCTTTGAAGGAGCTGG - Intergenic
1156642480 18:39119333-39119355 CAGAGACCTTTCGAAGGAACTGG + Intergenic
1156667370 18:39424856-39424878 CATAGACCCTTTAAAGGAAGCGG + Intergenic
1157507396 18:48238395-48238417 CAAAGACCTTTTGAAGGAAGCGG + Intronic
1157540834 18:48505409-48505431 CACAGATCCTCTGAAGGAAGTGG + Intergenic
1158002482 18:52635955-52635977 CACAGACCCTCTGACGGAAGTGG + Intronic
1158829628 18:61263435-61263457 CACAGACCCTCTGAAGGAAAAGG + Intergenic
1159454168 18:68639286-68639308 CATAGACCCTTTGAAGGAAGTGG - Intergenic
1159786962 18:72726476-72726498 CACAGACCTTCTGAAGGAAGTGG + Intergenic
1159838398 18:73369080-73369102 CACAGACCCTTCGAAGGAACCGG + Intergenic
1160058516 18:75508949-75508971 CACAGATCCCTTGAAAGAAGTGG + Intergenic
1160219773 18:76966103-76966125 CACAGACTCTCTGAAGGAAGTGG - Intronic
1160267733 18:77354427-77354449 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1161645488 19:5451026-5451048 CACAGTCCGTGTGAAGGGACGGG - Intergenic
1162285950 19:9739003-9739025 CACATTCCCTTTGGAGTAACAGG - Intergenic
1163679082 19:18670209-18670231 CACAGAGCCCTTGAAGGGAAAGG - Exonic
1163836889 19:19580423-19580445 CAGTGACCCTTAGAAAGAACGGG + Intronic
1163886767 19:19972127-19972149 CACAGACTCTTTGAAAGAAGTGG - Intergenic
1163950267 19:20577411-20577433 CACAGACTCTTTGAAAGAAGTGG - Intronic
1163967729 19:20763997-20764019 CACAGACTCTTTGAAAGAAGTGG + Intronic
1164267326 19:23632226-23632248 CACAGACCCTCTGAAGAAAATGG + Intronic
1164323878 19:24175379-24175401 CACAGAACTTTTGCAGGAATGGG - Intergenic
1164613879 19:29653356-29653378 CACACACCCTTTGTGGGAAAAGG - Intergenic
1164705667 19:30317529-30317551 CACAGACCCCTGGAAGGATGGGG - Intronic
1164966508 19:32489490-32489512 CACAGACAGTTTAAAAGAACAGG + Intergenic
1165114882 19:33522780-33522802 CACTGCCCCTGTGAAGGAAGGGG + Intergenic
1166604391 19:44127414-44127436 CACAGACCCTCTGAAGGAAGTGG - Intronic
1166899568 19:46049266-46049288 CAGAGACCCTTTAAAGGAGGTGG + Intronic
1167408572 19:49331117-49331139 CTCTGAGCCTTTGAAGGAAGTGG - Intergenic
1168649291 19:58083083-58083105 CACAGGCCCTTTCAAGTGACTGG + Intronic
924992889 2:329035-329057 CACAGACTCTTTAAAGGAGGTGG - Intergenic
925124239 2:1442880-1442902 CTCAGACTCTTTGAAGAAAGGGG - Intronic
925127475 2:1469841-1469863 CGCAGACCCTCTGAAGAAAGCGG - Intronic
925441962 2:3895645-3895667 CACAGACCCTTTGAAGGAGGTGG - Intergenic
925652377 2:6104656-6104678 CACATACCCTTTGAGGGAACTGG - Intergenic
925705493 2:6681207-6681229 CACAGACCCTTTGAAGGAGGTGG + Intergenic
925795720 2:7540011-7540033 CACAGACCCTTTGCGGGAACTGG - Intergenic
926867159 2:17372533-17372555 CACAGACCTTTTGAAAGAAGTGG - Intergenic
926872878 2:17441885-17441907 CACAGACCCTCTGAAAAAAGCGG - Intergenic
926916141 2:17893794-17893816 CACAGACCCTCTGAAGGAAGCGG - Intronic
926990876 2:18678113-18678135 CACAGACCCTTTGAAACAAATGG - Intergenic
927069820 2:19516363-19516385 CACAGACCCTTTGAAGAAACTGG - Intergenic
927248942 2:20981116-20981138 CACAGACCCAGTGAAGGACTGGG + Intergenic
928443366 2:31311930-31311952 CACAGACCCTCTGAAGGAAGTGG - Intergenic
928772663 2:34720342-34720364 CACAGACCCTCTGAAGGAAGCGG - Intergenic
928783133 2:34848885-34848907 CACCCACCCTTTGAAGGAAATGG - Intergenic
929051000 2:37836811-37836833 GACAGACCATTTGAAGTGACCGG - Intergenic
929197064 2:39195987-39196009 CACAGACCCTTTGAAGAAGGTGG + Intronic
930422146 2:51166553-51166575 CACAGACCCTTTGAAAGAAGTGG - Intergenic
930469480 2:51794728-51794750 CACATATCCTTTGAAGGAAGTGG + Intergenic
930593060 2:53353338-53353360 CACCGACCCTTTGAAGGAACTGG + Intergenic
930703625 2:54483737-54483759 CACAGGCCCTGTGAAGCCACTGG - Intronic
931547750 2:63408195-63408217 CACAGACTCTCTGAAGGAAGCGG + Intronic
931834546 2:66085314-66085336 CACAGAACCTTTGGAGGAAGTGG + Intergenic
932270239 2:70403077-70403099 CACAGACCCTCTGAAGGAAGTGG + Intergenic
932385034 2:71324059-71324081 CACAGATCCTCTGAAGGAAGTGG - Intronic
932883658 2:75527855-75527877 CACAAACCCTTTGAAAGCAGTGG + Intronic
932954774 2:76338026-76338048 CACAGACTCTCTGAAGAAAGTGG - Intergenic
933349451 2:81135889-81135911 CACAGACCCTTTGAAAGAAGTGG + Intergenic
933397462 2:81752029-81752051 TACAGATCCTTTGAAGGAAATGG + Intergenic
933433522 2:82215025-82215047 CACAGACTCTTTGAAGGAACTGG - Intergenic
933531388 2:83517044-83517066 CACAGACCCTCTGAAGGAAGTGG + Intergenic
934111545 2:88747846-88747868 CACAGACCCTTTGAAAGAAGTGG - Intronic
935006989 2:99089010-99089032 CACAGACCCTTTGAAGGAAGAGG + Intronic
936102193 2:109592042-109592064 CACAGACCCTTAGAAGCATAAGG + Intronic
936505113 2:113099548-113099570 CACAGACCCTTTGAAGGAGGCGG - Intergenic
936700997 2:115011781-115011803 CACACACCCTTTGAAAGAATTGG + Intronic
936850686 2:116894780-116894802 CACAGACCCTTTGAAGGAACTGG + Intergenic
936879609 2:117233558-117233580 TACAGACCCTTTGAAAGAAGTGG - Intergenic
936899345 2:117466459-117466481 CACAGATCTTTTGAAGGAAATGG - Intergenic
937057721 2:118953675-118953697 CACAGACCCTCTGAAGGAAGTGG + Intronic
937521653 2:122720248-122720270 CACAGACCCTCTGAAGGAAGGGG + Intergenic
937699493 2:124847607-124847629 CACAGACCCTTTGAAGGAACTGG - Intronic
937781983 2:125848896-125848918 CACAGATCCTCTGAAAGAAGCGG - Intergenic
938038294 2:128054417-128054439 CACAGACCCTCTGAAGGAAGTGG - Intergenic
938175556 2:129123986-129124008 CACAGACCCTTTCAAGGAGTTGG - Intergenic
938184273 2:129214672-129214694 TACTGTCCCTGTGAAGGAACTGG - Intergenic
938564299 2:132504085-132504107 CACAGATGCTTTGAAGAAACTGG - Intronic
938660949 2:133486838-133486860 CAATGACCCGTTGAATGAACTGG - Intronic
938674161 2:133614109-133614131 CGCAGAGCCTTTGAAGAAACTGG + Intergenic
938996327 2:136682919-136682941 CACAGACCCTTTGAAGGAACTGG + Intergenic
939476351 2:142693218-142693240 CATAGTTCCTTTGAAGGAACTGG + Intergenic
939834816 2:147116474-147116496 CACAAACTCTTTCAAGAAACTGG - Intergenic
940131645 2:150388672-150388694 AACAGAACCTTTGAAAGAAATGG - Intergenic
940216491 2:151308948-151308970 CACAGACCCTCTGAAGGAAGAGG + Intergenic
940384897 2:153058811-153058833 CACAGACCCTTTGAAAGAAGTGG - Intergenic
940423791 2:153508709-153508731 CATAAACCCTTTGAAGGAACTGG - Intergenic
940431218 2:153592692-153592714 CACAGACCCTCTGAAGGAAATGG + Intergenic
940618815 2:156084514-156084536 CACAGACCCTCTGAAGGAAGCGG - Intergenic
940630200 2:156229257-156229279 CACGGACCCTTTGAAATAAGTGG + Intergenic
940762261 2:157751060-157751082 AACGGACCCTTTGAAGGAAGTGG + Intronic
941060479 2:160841962-160841984 CACAGATCCTTTGAAAGACATGG + Intergenic
941402316 2:165045626-165045648 CACATACCCTTTGAAAGAAGCGG - Intergenic
941431343 2:165417837-165417859 CACAGACCCTTTGAAAGAAGTGG - Intergenic
941627301 2:167844358-167844380 CACAGACCCTCTGAAGGAAGCGG + Intergenic
943348617 2:186771550-186771572 CACAAGCCCTTTGAAGGAAGCGG + Intergenic
943449410 2:188028993-188029015 CGCAGACCCTTTGAAGGAGGTGG - Intergenic
943621283 2:190150586-190150608 CACACACCCTCTGAAGGAAGTGG - Intronic
944139061 2:196434985-196435007 CACAGACACTTTGGATGAAGAGG + Intronic
944485320 2:200199564-200199586 CACAGACCCTTTGAAGGAATTGG + Intergenic
944529021 2:200649480-200649502 CACAAACCCTCTGAAGGAAGTGG - Intronic
944601990 2:201312823-201312845 CACAGACCCTCTGAAGGAAGTGG + Intronic
944900398 2:204207979-204208001 CACACACCCTTTGGGTGAACAGG + Intergenic
945075197 2:206031799-206031821 TACAGACCCTCTGAAGGAAGTGG + Intronic
945362225 2:208906219-208906241 CACACACCCTTTGAAGGAAGTGG + Intergenic
945377353 2:209094481-209094503 CACAGACCCTTTGAAGGAACTGG - Intergenic
945657687 2:212644772-212644794 CACAGACCCTTTGAAGGAGGTGG - Intergenic
945739405 2:213642209-213642231 CACAAACCCTTTGGAAGAAGTGG - Intronic
945861630 2:215129293-215129315 CACAGACCTTCTGAAGGAAGTGG - Intronic
946208100 2:218125399-218125421 CACAGAACTTTTGAAAGAAGTGG - Intronic
947235992 2:227941381-227941403 CACAGACCCTTTGAAGGAAGTGG - Intergenic
947270204 2:228326449-228326471 CATGGACCCTCTGAAGGAAGTGG + Intergenic
947460383 2:230299197-230299219 CACACACCCTTTAAAAGAAGTGG + Intronic
947470652 2:230398530-230398552 CACAGACCCTTTGAAAGAAGTGG + Intronic
948531067 2:238606015-238606037 CACAGACCCTCTGAAGGAATCGG + Intergenic
948713875 2:239846563-239846585 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1168748623 20:266343-266365 CACAGACCCTCTGAAGGAAACGG - Intergenic
1169083861 20:2815233-2815255 CCCAGGCCCCTTGGAGGAACTGG - Exonic
1170086202 20:12535250-12535272 CACAGACCCTTTGAAGGATCTGG + Intergenic
1170721158 20:18880009-18880031 CAAAGACCCTCTGAAGGAAGTGG - Intergenic
1170727662 20:18943970-18943992 CACAGAACTTTTGAAGAAACTGG - Intergenic
1170740994 20:19056546-19056568 CACAGACCCTTTGATGGCACTGG + Intergenic
1171579716 20:26437810-26437832 AACATTCCCTTTGATGGAACAGG + Intergenic
1171583155 20:26484863-26484885 AACATTCCCTTTGATGGAACAGG + Intergenic
1171587104 20:26540938-26540960 AACATTCCCTTTGATGGAACAGG + Intergenic
1172026744 20:31953797-31953819 CACAGGCCCTGAGAAGGAAAGGG + Intergenic
1172851501 20:37969468-37969490 CACAGACCCTTTAAAGGAACTGG - Intergenic
1173568320 20:44058114-44058136 CACAGACACTTTGAAGGATGTGG + Intronic
1174972723 20:55294978-55295000 CATAGACCCATTGAGGGAAGGGG - Intergenic
1175068935 20:56315806-56315828 TACAGACCCTCTGAAGGAAGAGG + Intergenic
1175140605 20:56858182-56858204 CACAGAGCATGTGCAGGAACAGG - Intergenic
1176886464 21:14261522-14261544 CACAGACACTTTGAAGGGTGCGG - Intergenic
1177176339 21:17704363-17704385 AGCAGACCCTCTGAAGGAAGTGG + Intergenic
1177681403 21:24375880-24375902 CACAAACCCTTTGAAGGATGCGG - Intergenic
1177847287 21:26305744-26305766 CACAGACCCTCTGAAGAAAGTGG + Intergenic
1177995485 21:28090658-28090680 CACAGCCCCTCTGAAGGAAGCGG - Intergenic
1178038146 21:28608553-28608575 CATAGACCCTTTGAAGGAGGTGG + Intergenic
1178732802 21:35120406-35120428 CATAGACCCTTCAAAGGAACTGG + Intronic
1178801550 21:35800680-35800702 CACAGACCCTCTGAAGGAAGTGG + Intronic
1178822020 21:35984034-35984056 CTCAGACCCTTTGCAGGTCCTGG + Intronic
1179443198 21:41410587-41410609 CACAGACCCTTTGAACAAAGTGG + Intergenic
1179467907 21:41589927-41589949 CACAGACCCTTTGAAGGAACGGG - Intergenic
1179567105 21:42256080-42256102 CAGAGACCCTTGGAAAGAAAGGG - Intronic
1180896338 22:19336326-19336348 CACAGATCCTTTGAAAGAAGTGG + Intronic
1181371024 22:22417001-22417023 CACAGACCCTCTGAAGGAAGGGG + Intergenic
1181454203 22:23047093-23047115 CACAGACCCTCTTAAGGAAGTGG + Intergenic
1181712593 22:24699926-24699948 CAAAGGCCCCTTGAAGGATCAGG + Intergenic
1182649587 22:31840321-31840343 CACAGAGCCTTTGCACAAACTGG - Intronic
1182763311 22:32740394-32740416 CTGAAACCCTTTGAGGGAACTGG + Intronic
1183008079 22:34920006-34920028 AAGAGACCATTTGAAGAAACTGG + Intergenic
1183048591 22:35241803-35241825 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1183170428 22:36183699-36183721 CCCAGAGCCCTTGAAGGAAAGGG + Intergenic
1183175774 22:36223770-36223792 CCCAGAGCCCTTGAAGGAAAGGG + Intergenic
1183178813 22:36244776-36244798 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1183509298 22:38225623-38225645 GACAGACCCTTGGAGGGAAGGGG + Intronic
1184351736 22:43948861-43948883 GACAGACCCTTTAAAGGAAACGG + Intronic
949189546 3:1235706-1235728 CACAAACCCTTTGAAAGAACTGG + Intronic
949576475 3:5343397-5343419 CACAGACCATTTGAAGGGGGAGG + Intergenic
949604178 3:5635072-5635094 CACAGACCCTCTGAAGAAAGCGG - Intergenic
950603682 3:14058503-14058525 CACAGACCCTCTGGAGGAAGTGG - Intronic
951183670 3:19688065-19688087 CACAGACCCCCTGAAGAAAGCGG + Intergenic
951262287 3:20523982-20524004 CACAGACTCTTTGAAGGAAGTGG - Intergenic
951302720 3:21017936-21017958 CGCAGACCCTTTCAAGGAACTGG - Intergenic
951691139 3:25397414-25397436 CACAGACCCTTTGAAGGAAGTGG - Intronic
952024029 3:29057381-29057403 CACAGACCCTTTGAAGGAGGTGG + Intergenic
952097331 3:29968727-29968749 CACAGACCCTCTGAAGGAAGCGG - Intronic
952122593 3:30263157-30263179 CACAGACCCTTTGAAAGAAGTGG + Intergenic
952183353 3:30942353-30942375 CACAGATGCTTTGAAAGAAGTGG - Intergenic
952305131 3:32138652-32138674 CACAGATTCTGTGAATGAACTGG - Exonic
952689814 3:36191880-36191902 CACAGACCCCCTGAAGGAAGTGG - Intergenic
953284351 3:41592066-41592088 CACAGACCCACTGAAGGAAGCGG + Intronic
953382083 3:42479698-42479720 CACAGATTCTTTGAAAGAAGTGG + Intergenic
953495139 3:43379514-43379536 CACAGACCCTTTAAAGGAGATGG + Intronic
953724090 3:45382271-45382293 CACAGACCCTCTGAGGGAAGTGG - Intergenic
953866458 3:46587292-46587314 CACAGACCCTCTCAAGGAAGTGG + Intronic
954501981 3:51025983-51026005 TACAGACCCTTTGAAACAAATGG - Intronic
954517508 3:51191636-51191658 CACAGACCCTTTAAAAGAAGTGG - Intronic
955450886 3:59065406-59065428 CCCAGACCCTTTGAAGGAAGTGG - Intergenic
956632856 3:71332987-71333009 CTCTGACCCTTTGTTGGAACGGG - Intronic
956950132 3:74273419-74273441 CACAGACCCTCTGAAGGAAGTGG + Intronic
957427773 3:80063226-80063248 CACAGATCCTCTGAAGGGAAAGG + Intergenic
957896338 3:86425007-86425029 CTCCCACCCTTTGAAGTAACAGG + Intergenic
958013675 3:87913985-87914007 CACAGACCCCCTGAAGGAAGCGG + Intergenic
958263039 3:91404434-91404456 CTCAGACTCTCTGAAGGAAGCGG - Intergenic
958480896 3:94644048-94644070 CACAAATCCTCTGAAGGAAATGG - Intergenic
958787547 3:98613790-98613812 CACAGACTCTGTAAAGGAAGTGG - Intergenic
959046852 3:101484491-101484513 CACAGACCCTCTAAAGGATGTGG + Intronic
959125970 3:102290716-102290738 CACAAACCCTTTAAAGAAACTGG - Intronic
959275357 3:104270351-104270373 CACAGACCCTCTGAAGGAAGTGG - Intergenic
959390716 3:105770222-105770244 CACAGACCCTGTGAAAGAATTGG + Intronic
959757398 3:109915151-109915173 CACAGACACTTCAAAGGAACTGG - Intergenic
959802638 3:110513039-110513061 CACAGATCCTCTGAAGGAAGTGG - Intergenic
959875051 3:111372941-111372963 CACAGGCCCTCTGAAGAAAGCGG + Intronic
959997136 3:112692737-112692759 CACAGACCCTCTGAAGGAAGTGG + Intergenic
960064296 3:113354293-113354315 CACAGACCCTTTGAAGGAACTGG + Intronic
960153282 3:114272464-114272486 CATAGACCCTTTGAAAGAAGTGG - Intergenic
960513041 3:118572685-118572707 CACAGACCCTCTGAAGGAAGTGG - Intergenic
960516419 3:118607596-118607618 CACACACCCTCTGAAGGAAGTGG + Intergenic
960756399 3:121018870-121018892 CACAGACCCTTTGAAGGAGGTGG + Intronic
960915938 3:122694922-122694944 CAAAGACCCTTTCAAGGAGAAGG + Intronic
961968019 3:130926118-130926140 CACAGACCCTTTGAAGAAATTGG - Intronic
961978204 3:131048664-131048686 CACAGATCCTTTGAAGGAAGCGG - Intronic
962012621 3:131407824-131407846 CGCAAACCCTTTGAAGGAGGTGG + Intergenic
962034397 3:131636135-131636157 CACAGACCCTTTGAAGGAACTGG + Intronic
962066126 3:131981954-131981976 CACAGACCCTCTGAAGAAAGGGG - Intronic
962504903 3:136036639-136036661 CACAGACCCCCTGAAGGAAGCGG - Intronic
962709359 3:138072667-138072689 CATAGACCCTGTAAAGGAACTGG + Intronic
962984107 3:140518686-140518708 CACAGACCCTTTGAAGGAAGTGG - Intronic
962994926 3:140617163-140617185 CACAGACCCTTGGAAGGAGGTGG + Intergenic
963373932 3:144438397-144438419 CACAGACCCTCTGAAGGAACTGG - Intergenic
963522571 3:146373356-146373378 CACAGATGCTTTGAAGAAACTGG - Intergenic
963832413 3:150022639-150022661 CACAGACAGTTTGAAGGAACTGG + Intronic
964017433 3:151964679-151964701 CACAGACCCTTTGAAGGAACTGG + Intergenic
964160507 3:153640352-153640374 CACAGACCTTCTGAAGGATGTGG + Intergenic
964226399 3:154408324-154408346 CACAGACCCACTGAAGGAATTGG + Intronic
964299290 3:155270722-155270744 CACAGACTCTTTGAAAGAACTGG + Intergenic
964636139 3:158860030-158860052 CACAGACCCTTTGAAACACAAGG - Intergenic
964661660 3:159126504-159126526 CACAAACTTCTTGAAGGAACAGG + Intronic
964794004 3:160478488-160478510 CACAGACCCTTTGAAGAAACTGG + Intronic
964867233 3:161275397-161275419 CACAGACCCTTTGAAATAAGCGG + Intergenic
965184965 3:165451493-165451515 CACAGATACTTTGAAAGAAGTGG + Intergenic
965296707 3:166955989-166956011 CACAGACCCTTTGAAGGAACTGG - Intergenic
965745465 3:171920432-171920454 GACAGACCTTCTGAAGGAAGCGG + Intronic
966117805 3:176485851-176485873 CACAGACCCTCTGAAGGACGTGG - Intergenic
966122289 3:176536350-176536372 CACAGACCCTCCGAAGGAAGTGG + Intergenic
966229973 3:177641069-177641091 CACAGACCCTCTGAAGGAACTGG - Intergenic
966352539 3:179046503-179046525 CACAGGCCCTTTGAAGGAGGCGG + Intronic
966445469 3:179997056-179997078 CCCAGACCCCTTGAATGAAGGGG + Intronic
967434595 3:189430226-189430248 CACAGACCCTTTGAAAGAAGTGG + Intergenic
967504462 3:190238526-190238548 CACAGAGCCTTTGAAAGAAGAGG + Intergenic
967651212 3:191989609-191989631 CACAGACCCTCTGAAGGAAATGG + Intergenic
967958820 3:194901786-194901808 CACAGACCCTTTGAAAGAAGTGG - Intergenic
969165614 4:5308253-5308275 CACAGACCTTTTCAAGGAAGTGG - Intronic
969813310 4:9666963-9666985 CACAGACCCTTTAAGGTATCGGG - Intergenic
969852356 4:9970017-9970039 CACAGACTCTTTGAAAGAAGTGG + Intronic
969901791 4:10356673-10356695 TTCAGACCCTTTGAAAGAAGTGG - Intergenic
970200920 4:13603994-13604016 GACAAACCTTTTGAAGAAACTGG - Exonic
971472425 4:27041010-27041032 CACAGACCCTTTGAAGGAAGCGG - Intergenic
971576339 4:28280143-28280165 CACGGTCCCTTTGAAGGAGGTGG + Intergenic
971927903 4:33037848-33037870 CACAGACACTTTGAAGGGTGAGG - Intergenic
972189203 4:36569320-36569342 TACAGACTCTCTGAAGGAAGCGG - Intergenic
972209689 4:36822809-36822831 CACAGACCCTTTGAAAGAAGTGG + Intergenic
973676100 4:53264288-53264310 CACAGACCATTTGGAGGAACTGG - Intronic
973782267 4:54300044-54300066 CACAGACCCTCTGATGGAAGTGG + Intergenic
973786951 4:54341461-54341483 CACAGACCCTCTGAAAGAGGTGG + Intergenic
973831577 4:54764877-54764899 CACAGACCACCTGAAGGAAGTGG - Intergenic
974127034 4:57709483-57709505 CACAGACACTTTGAAGGAAGTGG + Intergenic
974474586 4:62362276-62362298 CACAGACCCTTGGAAGGAAGCGG - Intergenic
974801939 4:66828849-66828871 CACAGACCCTTTGAAGGAGGTGG - Intergenic
974857296 4:67476272-67476294 CACAGACTCTTTGAAAGAAATGG + Intronic
974921440 4:68245382-68245404 TACAGACCCTTTGAAGTCTCTGG - Intronic
974985681 4:69023514-69023536 CACAGACTCTCTGAAGGAACTGG - Intronic
975203044 4:71614485-71614507 CACAAACGCTTTGAAGGAACTGG + Intergenic
975365258 4:73521226-73521248 CACAAACCCTTTAAAGGAACTGG - Intergenic
975680065 4:76867656-76867678 CACAGACCCTCTGACAGAAGTGG + Intergenic
975790473 4:77944306-77944328 CACAGACCCTTTGAAGGAAGTGG - Intronic
975814967 4:78208011-78208033 CACATACCCTCTGAAGGAAGTGG + Intronic
975928844 4:79492759-79492781 CACAGACCATTTGAAATAAGCGG - Intergenic
976686466 4:87820137-87820159 CACAGACCCTCTGAAGGACGTGG - Intergenic
976791136 4:88880193-88880215 CACAGACCCTTTGAAGGAAGTGG + Intronic
976963247 4:91004100-91004122 CACAGACTCTCCGAAGGAAGTGG - Intronic
976988800 4:91337724-91337746 CACAGACCCTTTCAAGAACTAGG + Intronic
977020132 4:91747619-91747641 CACAGACCCTCTGAAGGAAGTGG - Intergenic
977489197 4:97691160-97691182 CACAGACCCTTTGAAGGAGGTGG + Intronic
977510336 4:97953813-97953835 CACAGACCCTTTGAAAGAAGTGG - Intronic
977635491 4:99293455-99293477 CACAGACCCTTTGAAGGCGGTGG + Intergenic
977852618 4:101848237-101848259 CACAGACCCTCTGGAGGAAGCGG - Intronic
977905585 4:102474802-102474824 CACAGATCCTTTGAAAGAAGAGG + Intergenic
977976173 4:103269178-103269200 CATGGACCCTTTGAAGGAACTGG - Intergenic
978761781 4:112361204-112361226 CACAGACCCTTTGAAGGAGGTGG + Intronic
978916028 4:114127155-114127177 CATAGACCATTTGAAGGAGGTGG + Intergenic
978924864 4:114231277-114231299 CACAGATCCTTTGAAGGCAGTGG + Intergenic
979030223 4:115633790-115633812 CACAGACCTTTTGAAGGAACTGG - Intergenic
979356823 4:119714899-119714921 CACAGACCCTTTGAAAGAAGTGG + Intergenic
979498558 4:121412036-121412058 TACAGATCCTCTGAAGGAAGTGG - Intergenic
979995341 4:127425475-127425497 CACAGACTCTCTGAAGGACGCGG + Intergenic
980087323 4:128404289-128404311 CACACACCCTCTAAAGGAAGCGG - Intergenic
980263209 4:130481456-130481478 CACAGACCCTCCGAAGGAAGTGG + Intergenic
980274534 4:130632909-130632931 CACAAACCCTTTGAAGGTGGTGG + Intergenic
980410011 4:132404312-132404334 AACAGACCCTTTGAAGGAACTGG - Intergenic
980645026 4:135632951-135632973 CACAGACCCTTTGAAGGAACTGG - Intergenic
980761487 4:137239245-137239267 CACAGACCCTTTGAAGGAACTGG - Intergenic
980861111 4:138500379-138500401 TACAGACCCTTTGAAGGAACTGG - Intergenic
980926588 4:139144103-139144125 CACAGATCCTTTGAAAGAAGGGG + Intronic
981064065 4:140462942-140462964 CACAAACCCTTTGAAAGAACTGG + Intronic
981167573 4:141580505-141580527 CACAGGCGCTTTGAAGGAACTGG + Intergenic
981346499 4:143683286-143683308 CACAGACCCTCTGAAGGAAGCGG + Intronic
981366871 4:143914203-143914225 CACAGACCCTCAGAAAGAAGCGG + Intergenic
981376668 4:144024441-144024463 CACAGACCCTCTGAAGGAAGTGG + Intergenic
981442657 4:144800174-144800196 CACAGACCCTTTGAAAGAAGTGG - Intergenic
981460972 4:145013696-145013718 CACAGACCCTCTGAAAAAAGCGG + Intronic
981760933 4:148193357-148193379 CACAGACCCTCTGAAGGAAGCGG - Intronic
982190066 4:152844294-152844316 CACAGACCCTCTGAAGGAAGCGG - Intronic
982299563 4:153865271-153865293 CATAGACCCTTTGAAGGAGATGG - Intergenic
982473471 4:155822038-155822060 CACAGACACTTTGAAGGATGAGG - Intergenic
982477507 4:155871988-155872010 CACAGACACTTTGAAGGGTGAGG + Intronic
982800414 4:159698493-159698515 CACAGACCCATTGAAAGAAGTGG - Intergenic
982829348 4:160041930-160041952 CACAGACCCTTTGTAGGAAGTGG + Intergenic
982960434 4:161828336-161828358 CACAGACTCTTTGAAGGAAGTGG - Intronic
982991759 4:162285779-162285801 CACAGACCCTTTGAAGGAACTGG + Intergenic
982994453 4:162323378-162323400 CACATACCCTATGAAGGAGCTGG - Intergenic
983251620 4:165352099-165352121 CACAGACCCTTTGAAAGAACTGG - Intergenic
983449638 4:167894744-167894766 CACAGACCCTCTGAAGGAAGCGG + Intergenic
983547248 4:168977051-168977073 CACAGACCCTTTGTAAGAAGTGG - Intronic
983729945 4:170980002-170980024 CACAGACCCTTTGAAGGAGGTGG - Intergenic
983754632 4:171319921-171319943 CACAGACACTTTGAAGGAGGTGG + Intergenic
983845709 4:172514979-172515001 TTCAGACCCTTTGAAAGAAGTGG - Intronic
984234228 4:177137010-177137032 CATAGACCCTTTGAAAGAACTGG + Intergenic
984266838 4:177506121-177506143 CACAGACCCTATGAAGGAAGCGG - Intergenic
984619667 4:181937948-181937970 CACAGAGCCTTGGATGGAAAAGG - Intergenic
985092730 4:186381248-186381270 CGCAGACCCTCTGAAGGAAGTGG + Intergenic
985217925 4:187672599-187672621 CGCAGACCCTCTGAAGGAAGTGG - Intergenic
985240943 4:187930110-187930132 CATAGACCCTCTGAGGGAAGTGG - Intergenic
985275564 4:188234235-188234257 CACAGAAACTGTGAGGGAACCGG + Intergenic
985313048 4:188624733-188624755 CACAGAGCCTTGGAAGATACAGG - Intergenic
985416593 4:189741762-189741784 CACAGACCCTTTGAAAGAAGTGG + Intergenic
986258949 5:6125909-6125931 CACAGACTCTTTGAAGAAACTGG + Intergenic
986633929 5:9801528-9801550 CACAGACCCTTTGAAGGAAAGGG + Intergenic
986644598 5:9904167-9904189 CACAGACCCTTTGAAGGAGGTGG - Intergenic
986748689 5:10765594-10765616 CACAGACACTTTGAAGGGTGGGG - Intergenic
986870125 5:12036164-12036186 CACAGACCTTTTGAAGGAAGTGG + Intergenic
987005957 5:13709658-13709680 CACAGACTCTGTGAAGGAGGCGG + Intronic
987030531 5:13972712-13972734 CACACACCCTTTGAAGGAAGCGG - Intergenic
987414305 5:17647234-17647256 CACAGACCCTCTAAAGGAAGTGG - Intergenic
987436957 5:17906210-17906232 CACAGACCCTCTGAAAGAGGTGG - Intergenic
987563519 5:19555270-19555292 CACAGACCCTTTGAAAGAGGTGG + Intronic
987704350 5:21444097-21444119 CACAGACCCTATGAAGGAAGGGG - Intergenic
987846752 5:23296446-23296468 CACAGACTCTTTGAAGGAACTGG - Intergenic
988063004 5:26197843-26197865 CACAGACCCTTTACAGGTGCCGG - Intergenic
988421250 5:31008433-31008455 CACAGATCCTTTGAAGGAACTGG - Intergenic
988652513 5:33167665-33167687 CACAGACTGTTTGAAAGAAGTGG - Intergenic
988712725 5:33794301-33794323 CACAGACCCTCTGAAGGAAGCGG - Intronic
988875659 5:35443480-35443502 CACAGATCCTTTGAAAGAAGTGG + Intergenic
988889348 5:35598320-35598342 CATAGATCCTTTGAAAGAAGTGG + Intergenic
989073249 5:37534001-37534023 CATAGACCCTTTGAGGTAACTGG - Intronic
989355521 5:40539662-40539684 CACAGACACTTAAAAGGAACTGG - Intergenic
989431609 5:41361397-41361419 CACAGACTATATGAAGAAACTGG - Intronic
989818641 5:45766377-45766399 CACAGACTCTTTGAAAGAAGTGG - Intergenic
990137807 5:52668554-52668576 CACAGATCCTCTGAAGGAAGCGG + Intergenic
990659450 5:57996628-57996650 CAGGGAACCTCTGAAGGAACAGG + Intergenic
990899695 5:60737285-60737307 CACAAACCCTCTGAAGGAAGTGG - Intergenic
990918644 5:60937780-60937802 CACAGACCCTTTGAAGGAAGTGG - Intronic
992599827 5:78388060-78388082 CACAGACCCTTTGAAGAAGGTGG - Intronic
993250421 5:85513748-85513770 CACAGACCCTCTGAAGGAAGGGG - Intergenic
993742890 5:91562393-91562415 CGCAGACCCTTTGAAGGAAATGG + Intergenic
993920565 5:93795446-93795468 CACAGACCCTCTGAAGGAACTGG - Intronic
994399186 5:99257381-99257403 CATAGATCCTTTGAAAGAAGTGG - Intergenic
994496132 5:100516536-100516558 CACAGACCCTTTGAAAGCAGTGG + Intergenic
994564159 5:101418989-101419011 CACAGACCCATTGAAACACCAGG - Intergenic
994871121 5:105351348-105351370 CATAGACCCTTTGAAGGAAGTGG - Intergenic
994908443 5:105869580-105869602 CACAGACCCTTTGAAAGAAGTGG - Intergenic
995474350 5:112532734-112532756 CACAGACCCTCCGAAGGAAGTGG - Intergenic
995714909 5:115072799-115072821 CACATAGCCTGTGAAAGAACTGG + Intergenic
996010623 5:118478458-118478480 CACAGACCCTCTGAAGGAAGTGG + Intergenic
996080678 5:119255312-119255334 CACAGACCCTTTGAAGGAAGTGG + Intergenic
996128399 5:119752650-119752672 CACAGACCCTCTGAAGGAAGTGG + Intergenic
996327123 5:122287236-122287258 CACAGACCTTTTGAAAGAAGTGG - Intergenic
996495414 5:124149332-124149354 CACGGACCCTTGGAAGGAAGTGG - Intergenic
996609125 5:125358345-125358367 CACAGACCCTTTGAAAGAAGAGG - Intergenic
996615827 5:125440637-125440659 CACAGATCCTTTGAAGGAAGTGG + Intergenic
996668029 5:126083644-126083666 CACAGATCCTTTGAAAGCAGTGG + Intergenic
996677049 5:126188250-126188272 CACAGACACTTTGAAGGGTGAGG - Intergenic
996875427 5:128235475-128235497 CACAGACCCTTCGAAGGAATTGG - Intergenic
997005067 5:129806669-129806691 TACAGACCCTTTGAAGGAAGTGG - Intergenic
997231154 5:132244008-132244030 CACAGACCCTTTGAAGGAACTGG - Intronic
997760789 5:136445861-136445883 CACAGACCCTCTGAAGGAAGTGG + Intergenic
998708651 5:144795103-144795125 CACTGAAGCTTTGAAAGAACTGG - Intergenic
998746034 5:145260812-145260834 TACAGACTCTTTGAAGGAGGTGG + Intergenic
998758496 5:145406687-145406709 CACAGATCCTTTGAAAGAAGTGG + Intergenic
999337395 5:150734239-150734261 CACAGACCCTTTAAAAGAAGTGG + Intronic
999491142 5:152052730-152052752 CACAGACCCTCTGAAGGAAGGGG - Intergenic
999676969 5:154014414-154014436 CATATACCCTCTGAAGGAAGTGG + Intronic
999823015 5:155247568-155247590 CACAGACCCTTTGAAAGAAGTGG - Intergenic
999913369 5:156230603-156230625 CATAGACCCTTTGAAGGAAGCGG - Intronic
1000264368 5:159620770-159620792 AACAGACTCTTTGAAAGAAGTGG + Intergenic
1000779523 5:165464314-165464336 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1001290740 5:170457410-170457432 CACAGACCCTCTGAAGGAAGTGG + Intronic
1001693832 5:173654398-173654420 CACAGACCCTTTAAAGGAGGTGG - Intergenic
1002680670 5:180960426-180960448 CACAAACTCTTTGAAAGAAGTGG - Intergenic
1002804312 6:557752-557774 GACCAGCCCTTTGAAGGAACAGG + Intronic
1002865779 6:1121232-1121254 CACAGACCCTAGGAAGGATGAGG + Intergenic
1003029578 6:2589969-2589991 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1003552453 6:7110401-7110423 CACAGAACTTCTGAAGGAATGGG + Intronic
1003581797 6:7347205-7347227 CACAGGCCCTCTGAAGGAAGCGG + Intronic
1003712055 6:8603080-8603102 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1004600603 6:17145837-17145859 CACAGATCCTCTGAAGGAAGCGG - Intergenic
1004888479 6:20074540-20074562 CACAGACCCTTTGAAGGAACTGG + Intergenic
1005072370 6:21873941-21873963 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1005191561 6:23229203-23229225 CACAGACCCTTTGAGGGAAGTGG - Intergenic
1005244064 6:23861811-23861833 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1005259580 6:24043402-24043424 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1006377266 6:33678459-33678481 CACAGAACTTCTGCAGGAACTGG - Exonic
1007186623 6:39977435-39977457 CACAGAATCTGTGAAAGAACCGG - Intergenic
1007864608 6:44955218-44955240 CACAGACCCCTTGAAGGAGGTGG + Intronic
1007878816 6:45139503-45139525 CACAGATCCTTTGAAACAAATGG + Intronic
1007892605 6:45309958-45309980 CACAGAACCTCTGAAGAAAGCGG + Intronic
1008042339 6:46815585-46815607 CATAGACCCTTTGAAGGAACTGG - Intronic
1008121591 6:47622718-47622740 GACAGACCCTCTGAAGAAAGCGG - Intronic
1008250910 6:49238559-49238581 CACAGACCCTTTGAAAAAAGTGG - Intergenic
1008256120 6:49302768-49302790 CACAGTCCCTCTGAAGGAAGTGG + Intergenic
1008290229 6:49705911-49705933 CACAGACCATTTGAAAGAAGTGG - Intronic
1008881218 6:56382508-56382530 CACAGTCCCTTTGAAGGTTAGGG - Intronic
1008882279 6:56393684-56393706 CACAGGCCCTTTGAAATAAGCGG + Intronic
1008992368 6:57618454-57618476 CTCAGACTCTCTGAAGGAAGCGG + Intronic
1009180992 6:60517566-60517588 CTCAGACTCTCTGAAGGAAGCGG + Intergenic
1009384249 6:63069360-63069382 CACAGGTCCTCTGAAGGAAGTGG - Intergenic
1009453031 6:63824508-63824530 CACAGACCCTCTGAAGGAAGTGG + Intronic
1009493730 6:64325142-64325164 CACAGACCCTCTGAAGGAAGTGG + Intronic
1009589082 6:65643030-65643052 ATCTGACCCTTTGAAGGAACTGG + Intronic
1009644238 6:66377383-66377405 CATGGACCCTTTGAAAGAAGTGG + Intergenic
1009800327 6:68528403-68528425 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1009866862 6:69408827-69408849 CACAGAACCTTTGAAGAAACTGG + Intergenic
1010009087 6:71028922-71028944 CACAGACCCTTTGAAGGAAGCGG - Intergenic
1010017677 6:71123173-71123195 TACAGATCCTTTGAAAGAAATGG - Intergenic
1010076502 6:71804087-71804109 CACAGACCCTCTAAAGGAAGAGG - Intergenic
1010165243 6:72906775-72906797 CACAGACCCTCTGAAGGAAGTGG - Intronic
1010500410 6:76593366-76593388 CACAGACCCTTAGAAGGAAGTGG + Intergenic
1010817592 6:80376507-80376529 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1011225089 6:85096586-85096608 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1011366242 6:86585274-86585296 CATACACCCTTTAAAGGAAGTGG - Intergenic
1011478120 6:87767585-87767607 CACAGACCCTTTGAATGAAGGGG - Intergenic
1011564127 6:88657133-88657155 CACAGACCCTTTGAAAGAAGTGG + Intronic
1011620547 6:89238117-89238139 CACGAACCCTTTGAAGGAAGTGG - Intergenic
1011817948 6:91214217-91214239 CAAAGACCCTTTGAAGGAAGTGG - Intergenic
1011832170 6:91387330-91387352 CACAGACCCTTTGAAGGGGATGG + Intergenic
1011833603 6:91403805-91403827 CATAGACCCTCTGAAGGAAGTGG + Intergenic
1011924020 6:92618617-92618639 GACAGACCCTTTGAAGGAATTGG - Intergenic
1011965925 6:93157100-93157122 CACAGACACTTTGATGGAACTGG - Intergenic
1012234279 6:96795120-96795142 CACAGACCCTCTGGAGGCCCAGG + Exonic
1012299292 6:97564057-97564079 TACAGACCCTGTGAAGGAACGGG - Intergenic
1012629178 6:101442223-101442245 CACAGACACTTTGAAGGGTGGGG + Intronic
1012793613 6:103733656-103733678 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1012806745 6:103904007-103904029 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1012869705 6:104658756-104658778 CACAGCCCCTTTGAAAGCAGTGG + Intergenic
1013159926 6:107533090-107533112 CACAGGACCTTTGAAGAAATGGG + Intronic
1013221447 6:108081022-108081044 CACAGACTCTCTGAAGAAAGCGG - Intronic
1013864828 6:114682854-114682876 CACAGACCCTCTAACGGAAGCGG - Intergenic
1013877737 6:114855228-114855250 CACAGACCCTCTAAAGGAAGCGG + Intergenic
1013901121 6:115156883-115156905 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1014088037 6:117371193-117371215 CACAGACGCTTTGAAGGAAGAGG + Intronic
1014313301 6:119831434-119831456 TACAGACCCTTTGAAAGAAGTGG - Intergenic
1014370456 6:120600803-120600825 AACAGACCCTTGGAAGGTAGAGG + Intergenic
1014420341 6:121235740-121235762 CACAGAACCTTTGAAGGAACTGG - Intronic
1014531494 6:122564217-122564239 CACAGATCCTCTAAAGGAAGTGG - Intronic
1014581397 6:123141913-123141935 CACAGGCCCTTTGAAAGAAGTGG + Intergenic
1014738637 6:125123720-125123742 CGCAGACCCTCTGAAGGAAGTGG + Intronic
1014750198 6:125246344-125246366 CACAGATCCTTTGAAAGGAGTGG - Intronic
1015196481 6:130529488-130529510 CACAGACACATTGATGGAAGTGG + Intergenic
1015347718 6:132179678-132179700 CACAGATCCTTTGAAGGAAGCGG + Intergenic
1015663410 6:135601013-135601035 CACAGACCTTCTGAAGGAAACGG - Intergenic
1015899736 6:138052517-138052539 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1016000318 6:139035124-139035146 CACAAATCCTTTGAAGTAACAGG + Intronic
1016031455 6:139343075-139343097 CACAGGCCCTTTGAAAGAAGTGG + Intergenic
1016045064 6:139472626-139472648 CAGAGACGCCATGAAGGAACTGG + Intergenic
1016216365 6:141608248-141608270 CACAGACCCTTTGAATGATGTGG - Intergenic
1016290144 6:142519303-142519325 CACAGATCCTCTGAAGGAAGTGG - Intergenic
1016351816 6:143176852-143176874 CACAGACCCTTTGAAGGAGGCGG - Intronic
1016384828 6:143520367-143520389 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1016425745 6:143934233-143934255 CACAGATCCTTTGAAAGAAGTGG - Intronic
1016485180 6:144529322-144529344 TACAGACCCTTTGAAGGAGGTGG - Intronic
1017190620 6:151649070-151649092 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1017326469 6:153146323-153146345 TGCAGACACTTTGAAGGAACTGG - Intergenic
1018168817 6:161127315-161127337 CACAGACCCTATGAAGGAGATGG - Intergenic
1018353517 6:162988061-162988083 CACAGATCCCTTGAAAGAAATGG - Intronic
1018596678 6:165488593-165488615 CACAGACCCTTTGTAGGAGGTGG + Intronic
1019445981 7:1071617-1071639 CACAGACCCTGGGCAGGAACAGG + Intronic
1020332472 7:7033385-7033407 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1020915109 7:14183902-14183924 CACAGACGCTCTGACGGAAGTGG + Intronic
1021081377 7:16369823-16369845 CACAGACCCTTTGAAAGAAGTGG + Intronic
1021466208 7:20946038-20946060 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1021755131 7:23844081-23844103 CACAGATCCTTTTAAAGAAGTGG - Intergenic
1021891147 7:25187581-25187603 CCTAGACCCTTTGTAGGAAGTGG - Intergenic
1021979832 7:26043696-26043718 CACAAACTCTCTGAAGGAAGTGG - Intergenic
1022414794 7:30168641-30168663 AACAGAGTCTTTGAAGGAAGGGG - Intergenic
1023144418 7:37135376-37135398 CACAGACCCTTTGAAGGAACTGG + Intronic
1023657658 7:42441260-42441282 CACAGACCCTTTGAAGGAACTGG - Intergenic
1023692481 7:42805642-42805664 CACAGATCCTTTGAAGGAGGTGG + Intergenic
1024367357 7:48536005-48536027 CACAGACCCTTTGAAGGAACTGG - Intronic
1024455647 7:49604317-49604339 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1024665651 7:51544405-51544427 CATAGACCCTTTGAAGTAGGTGG - Intergenic
1024745493 7:52400658-52400680 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1024839912 7:53574240-53574262 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1024918019 7:54525316-54525338 CACAGATCCCCTGAAGGAAGCGG - Intergenic
1025762593 7:64408396-64408418 CACAGAACTTTTGCAGGAATGGG + Intergenic
1025794885 7:64730070-64730092 CACAGACCCTCTGAAGAAAGTGG - Intergenic
1027295248 7:76763501-76763523 CACAGACCCTCTGAAGGAAGCGG + Intergenic
1027468227 7:78540972-78540994 CACAGACCCTTTGAAAGAAGTGG - Intronic
1027477762 7:78654936-78654958 AACAGACCCGTTCAAGGCACAGG - Intronic
1027963987 7:84981725-84981747 CACAGAGCCCCTGAAGGAAGTGG - Intergenic
1028197693 7:87926564-87926586 CACAGACCTTTTGAAGGAACTGG + Intergenic
1028261626 7:88673857-88673879 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1028328032 7:89550485-89550507 CACAGACCCTTTGAAAGAAGAGG - Intergenic
1028401437 7:90430004-90430026 CACAGACCCTTTGAAAGAAGCGG + Intronic
1028819584 7:95190726-95190748 CACAGATGCTTTGAAAGAAGTGG - Intronic
1028822515 7:95229263-95229285 CACAGACCTTTTGAAGGAACTGG + Intronic
1029052979 7:97708972-97708994 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1030325092 7:108211047-108211069 CACAGACTCTCTGAAGGAATTGG + Intronic
1030455744 7:109772287-109772309 CACAGATCATTTGAAGGAGGTGG + Intergenic
1030533410 7:110737174-110737196 CACAGACCCTTTGAAGGAACTGG + Intronic
1031138858 7:117919183-117919205 TACAGACCCTCTGAAGGAAGTGG + Intergenic
1031147807 7:118016600-118016622 CCCAGACCCTCTGAAGGAAGCGG + Intergenic
1031261316 7:119524800-119524822 CACAAACACTTTGATGGAAATGG + Intergenic
1031612881 7:123847016-123847038 CACAGACCATCTGAAGGAAGCGG - Intronic
1031616477 7:123887848-123887870 CACAGACACATTGAAGGATGAGG - Intergenic
1031655520 7:124349864-124349886 CACAGGCCATTTGAAGGAACTGG - Intergenic
1031799522 7:126224357-126224379 CACAGACCATTTGAAAGAAGTGG - Intergenic
1031879092 7:127176589-127176611 CACAGACCCTCTGAAGGAAGTGG + Intronic
1032329227 7:130962311-130962333 CACAGACCCTTTGAAGGGTGAGG + Intergenic
1032448969 7:132010227-132010249 CACAGACCCTTTGAAGGAACTGG - Intergenic
1032872012 7:135996216-135996238 CACAGAGCTTCTGAAGGAGCAGG - Intergenic
1032922784 7:136567751-136567773 CACAGACCTTCTGAAAGAAGCGG - Intergenic
1032935644 7:136728902-136728924 TGCAGACCCTTTGAAGAAACTGG + Intergenic
1033259712 7:139832101-139832123 CACAGACCCTCTGAAGGAAGCGG + Intronic
1033458720 7:141526133-141526155 CACAGAGCCTCTGAATGAAATGG - Intergenic
1034683328 7:152947704-152947726 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1035343752 7:158183799-158183821 CACAGAACCTTTGAAAGAAGTGG - Intronic
1035833743 8:2727091-2727113 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1036168737 8:6462749-6462771 CACAAACCCTTTGAGGAGACTGG - Intronic
1036506786 8:9364149-9364171 AACTGACCTTTTGAGGGAACAGG + Intergenic
1036844130 8:12150508-12150530 CACAGACCATTTGAAAGAAACGG - Intergenic
1037713604 8:21376561-21376583 AACAGACCCTCTGAAGGAAGTGG - Intergenic
1038367342 8:26949123-26949145 CTCAGACCCTCTGAAGGAAGTGG - Intergenic
1038398773 8:27267235-27267257 CAAAGACAGTTTGAAGGAAGGGG - Intergenic
1038426377 8:27466842-27466864 CACATGCCCTTTGAAGGTGCTGG + Intronic
1038908700 8:31937513-31937535 CACAGACCCTTTGAGGGAACTGG + Intronic
1039029998 8:33298939-33298961 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1039123438 8:34174954-34174976 CACAGACCCTCTAAAGGAAGTGG + Intergenic
1039571691 8:38592321-38592343 CACAGACCCCCTGAAGGAAGTGG + Intergenic
1039641354 8:39227119-39227141 CACAGACCCTCTAAAGGAAGTGG + Intronic
1039802388 8:40970657-40970679 CACAGACACTTTGAAGGGTGAGG + Intergenic
1039869255 8:41531606-41531628 CACAGACCTTTTTGAGAAACTGG + Intronic
1040399479 8:47033938-47033960 CACAGACCCTTTGAAGAAACTGG - Intergenic
1040551183 8:48438875-48438897 CAGACATCCTTTGAAGGAGCTGG + Intergenic
1040635803 8:49271166-49271188 CACAGACCCTCTGAAAGTAGTGG - Intergenic
1040967070 8:53093349-53093371 CACAGATGCTTTGAAGGAGGTGG - Intergenic
1040989700 8:53336374-53336396 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1041150280 8:54925602-54925624 CACAGACTCTTTGAAGGAGGTGG + Intergenic
1041227631 8:55716485-55716507 CACACACCCTCTGAAGGAGGCGG + Intronic
1041364038 8:57082924-57082946 CACAGACCCTCTGCAGGAAGTGG + Intergenic
1041401278 8:57448076-57448098 CACAGACACTTTGAAGGGCGAGG + Intergenic
1041570698 8:59333801-59333823 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1041906050 8:63035059-63035081 CACAGACACTATGAAGGTAATGG - Intronic
1041927140 8:63248586-63248608 CACAGACCCTCTGAAGGATGTGG - Intergenic
1042143139 8:65699593-65699615 CACAGACACTTTGAAGGAGGTGG - Intronic
1042160627 8:65890670-65890692 CACAGATCCTTTGAAGGAAATGG + Intergenic
1042180643 8:66083977-66083999 AACAGGCCCTTGGAAGGCACAGG + Intronic
1042304272 8:67314662-67314684 CACAGACCCTCTGAAGGAAGTGG - Intronic
1042431341 8:68710235-68710257 CACAGACTATTTGAAGGAAATGG + Intronic
1042467274 8:69141524-69141546 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1042607865 8:70564887-70564909 CATAGATCCTTTGAAAGAAGTGG + Intergenic
1042645591 8:70982680-70982702 CACAGACCCTTTGTAGGAACTGG - Intergenic
1042768477 8:72352998-72353020 CGCAGACCCTTTAAAGGAGGTGG - Intergenic
1042971586 8:74415478-74415500 CACAGACCCTTTGAAATATGTGG + Intronic
1043047928 8:75351704-75351726 CACAGACCCCCTGAAGGAAGTGG + Intergenic
1043071662 8:75643389-75643411 CACAGACTGTCTGAAGGAAGTGG - Intergenic
1043104561 8:76090893-76090915 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1043205882 8:77438491-77438513 CACAGATCCTCTGAAGGAACTGG - Intergenic
1043537941 8:81226601-81226623 CACAAATCCTTTGAAAGAAGTGG - Intergenic
1043545060 8:81306331-81306353 CACAGACCCTTTGAAGGTACTGG + Intergenic
1043556817 8:81439589-81439611 CACAGACCCTTTGAAGGAACTGG - Intergenic
1043876488 8:85491999-85492021 CACAGACCCTCTGAAGGAACTGG - Intergenic
1043986321 8:86696466-86696488 CACAGACCCTTTGAAAGAAGTGG - Intronic
1044657272 8:94561615-94561637 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1044788247 8:95819133-95819155 CACAGACCCTCTGAAGAAAGTGG - Intergenic
1044880797 8:96719965-96719987 CACAGACCCTTTGAATGAAGTGG - Intronic
1044903280 8:96972001-96972023 CACAGACCCTTTGAAGGAACTGG + Intronic
1044947965 8:97408403-97408425 CACAGACCCTTTGAAGGAACTGG - Intergenic
1045779699 8:105849090-105849112 CACAGACCCTTTGAAGGAAATGG + Intergenic
1045814336 8:106261815-106261837 CACAGACCCTTTGAAGGAACTGG - Intergenic
1045840526 8:106574623-106574645 CACAGACCCTCTGAAGGACAGGG + Intronic
1046033871 8:108817435-108817457 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1046074282 8:109298870-109298892 CGCAGACCCTCTGAAGGAAGTGG + Intronic
1046132883 8:109990212-109990234 CACAGACACTTTGAAGGGTGAGG + Intergenic
1046583340 8:116120707-116120729 CACAGACCCTGTGCAGGAATTGG + Intergenic
1046884241 8:119345659-119345681 CAAAGACATTTTAAAGGAACTGG + Intergenic
1047147935 8:122226597-122226619 CACAAACTCTTTGAAAGAAGTGG + Intergenic
1047161577 8:122386528-122386550 CCCAGAGCCCTTGAAAGAACAGG - Intergenic
1047384496 8:124396388-124396410 CACAGGCCCTTTGAAAGAAGTGG - Intergenic
1047890490 8:129303241-129303263 CAAAGACCCTTTGAAGGACCTGG - Intergenic
1047901992 8:129432495-129432517 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1048531172 8:135251768-135251790 CACAGACCCTTTGAAGGAACTGG - Intergenic
1050266429 9:3895315-3895337 CACAGAACCTTTGAACAAAAGGG + Intronic
1050400401 9:5247750-5247772 CACAGATGCTTTGAAGGAACTGG + Intergenic
1050476567 9:6046680-6046702 ACCAGACCCTTTGAAAGAAGCGG - Intergenic
1050903403 9:10974432-10974454 CACAAACCCTTTGAAGGAATTGG + Intergenic
1050987697 9:12103953-12103975 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1051273077 9:15374110-15374132 CAAAGACCCTTTGAAAGAAGTGG + Intergenic
1051881041 9:21840358-21840380 CAAAGATCCTTTGAAAGAAGTGG + Intronic
1052006713 9:23357943-23357965 CACAGACCCTTTGAACGAGGTGG - Intergenic
1052218290 9:25992357-25992379 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1052537013 9:29760900-29760922 CACAGACCATCTGAGGGAAGTGG + Intergenic
1052731597 9:32291935-32291957 CACAGACCCTCTGAAAGAAGTGG - Intergenic
1053005825 9:34603794-34603816 CACAGACCCTGGAAAGGAATGGG + Intergenic
1053231917 9:36417250-36417272 CACAGACCCTTTGAAATAAGCGG - Intronic
1053582363 9:39418734-39418756 CACAGAGCCATTGCAGGCACGGG - Intergenic
1054103941 9:60977473-60977495 CACAGAGCCATTGCAGGCACGGG - Intergenic
1054582406 9:66929373-66929395 CACAGAGCCATTGCAGGCACGGG + Intronic
1055156273 9:73066703-73066725 CACAGACCTTCTGAAGGAACTGG + Intronic
1055169111 9:73233069-73233091 CACAGCCCTTTGGAAAGAACTGG + Intergenic
1055244140 9:74220051-74220073 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1055911993 9:81363910-81363932 CACAGACCCTTTGAAGGAACTGG + Intergenic
1056322872 9:85452733-85452755 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1056696245 9:88856490-88856512 CAAAGACCCTTTGAAGGAGGTGG + Intergenic
1056813516 9:89782666-89782688 TCCAGACCCTTTGAAAGAACAGG + Intergenic
1056948012 9:91017353-91017375 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1057119643 9:92559499-92559521 CACAGACCCTCTGAGGGAAATGG - Intronic
1057342421 9:94214566-94214588 CACAGACACTTTGAAGGGTGAGG - Intergenic
1057987982 9:99736985-99737007 CAAAGAATCATTGAAGGAACTGG - Intergenic
1057999994 9:99855507-99855529 CACAGACTCTTTGAGGGTAAGGG - Intronic
1058030547 9:100192083-100192105 CACAGACCCTCTGAAAGAAATGG - Intronic
1058085170 9:100740448-100740470 CACAGGCCCTCTGAAGGAAGTGG - Intergenic
1058156804 9:101524848-101524870 CACAGACCCTCTGAAGGAAGCGG - Intronic
1058233526 9:102461354-102461376 CACAGCCCCTTTGAAGGACCTGG + Intergenic
1058275539 9:103037429-103037451 CACAGAATCTTTTAAGGAAGTGG + Intergenic
1058308543 9:103472073-103472095 CACAGGCCCTCTGAAGGAAGCGG - Intergenic
1058770723 9:108228571-108228593 CCCAGATCCTCTGAAGGAAGCGG + Intergenic
1058784698 9:108375379-108375401 CACAGACCCTTTGAAAAAAGTGG - Intergenic
1059609608 9:115878372-115878394 CACAGACCCTATGAAGGAAGGGG - Intergenic
1059833758 9:118127937-118127959 CATAGATCCTTTGAAAGAAGTGG + Intergenic
1060311246 9:122464453-122464475 CACAGACCCTTTGAGGGAGGTGG - Intergenic
1060314565 9:122497189-122497211 CACAGACCCTTTGAAGGAACTGG - Intergenic
1062239544 9:135528328-135528350 CACAGACCTTGTGATGGCACAGG + Intergenic
1062239552 9:135528377-135528399 CACAGACCTTGTGACGGCACAGG + Intergenic
1062581150 9:137229820-137229842 CACAGACCCTTTTGAGGGGCCGG + Intergenic
1062705116 9:137934541-137934563 CATAGACCCTCTGAAGGAAGCGG + Intronic
1185993873 X:4922281-4922303 CACAGACGCTCTGAAGGAAGCGG + Intergenic
1186308343 X:8289726-8289748 CACAGACCCTCTGAAGGAACTGG + Intergenic
1186458650 X:9730825-9730847 GACAGACCCTTTTCTGGAACAGG - Intronic
1186962951 X:14757451-14757473 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1187109270 X:16279299-16279321 CACAGACCCTTTTAAGGAGGTGG - Intergenic
1187219343 X:17308440-17308462 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1187462095 X:19496516-19496538 CACAGACCTTTTGAAAGAAGAGG - Intronic
1187588788 X:20693172-20693194 CACAGACCCTTTGAAGGAACTGG + Intergenic
1187681282 X:21770331-21770353 CACAGACCCTCTGAAGGAGGTGG + Intergenic
1187748254 X:22432964-22432986 CACAGACCCTCTGAAGGAAACGG + Intergenic
1187752250 X:22479173-22479195 CACAGATGCTTTGAAGGAACTGG - Intergenic
1188482099 X:30646769-30646791 CCCAGACCCTTAGAAACAACAGG + Intergenic
1188738116 X:33742660-33742682 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1188955965 X:36435473-36435495 CACACATTCTTTGAAAGAACTGG + Intergenic
1189117286 X:38356427-38356449 CACAGACACTTTGAAGGGTGAGG + Intronic
1189539441 X:41971081-41971103 CACAGATCCTCTGAAGGAAGTGG + Intergenic
1189567137 X:42254750-42254772 CACAGACCCTCTGAAGGAACTGG + Intergenic
1189600257 X:42616173-42616195 CACAGCTACTTTGAAGGAAGTGG - Intergenic
1189668497 X:43382889-43382911 CACAGAAACCTGGAAGGAACTGG + Intergenic
1189946116 X:46180544-46180566 CACAGATCCTTTGAAGGAAATGG - Intergenic
1190632240 X:52399230-52399252 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1191026463 X:55919371-55919393 CAGAGATCCTTTGAAGGAACTGG + Intergenic
1191045220 X:56129282-56129304 TACAGACCCTTTGAAGGAAGAGG + Intergenic
1191077408 X:56469588-56469610 CACAGACTCTTTGAAAGAAGTGG - Intergenic
1191616542 X:63176155-63176177 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1191619755 X:63202768-63202790 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1191692204 X:63952282-63952304 CACAGATCCTCTGAAGGCAATGG + Intergenic
1191813573 X:65218313-65218335 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1191884139 X:65872351-65872373 CACAGACCCTCTGAAGGAACTGG - Intergenic
1191906235 X:66093698-66093720 CACAGACTCTCTGAAGGAAGAGG - Intergenic
1191909348 X:66131274-66131296 CACAGACCCTTTCAAGGAACTGG - Intergenic
1191914565 X:66187671-66187693 CACAGACCCTCTGAAGGAAATGG - Intronic
1192014831 X:67317810-67317832 CATACACCCTCTGAAGGAAGTGG - Intergenic
1192206055 X:69097123-69097145 CAAAGGCCCTTTCAAGAAACAGG + Intergenic
1192609564 X:72554324-72554346 CACAGACCCTTTGAAGGAACTGG + Intronic
1192658079 X:73013252-73013274 CCCAGAACCTTTGAAAGAAGGGG - Intergenic
1192674212 X:73177580-73177602 CGCAGACCCTTTGAAGGAGGTGG - Intergenic
1192914643 X:75638958-75638980 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1192929491 X:75791400-75791422 CACAGTCCCTCTGAAGGAAGTGG + Intergenic
1192950763 X:76014103-76014125 CACAAACCCTTTGAAGGAAGTGG + Intergenic
1192968295 X:76203055-76203077 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1192981932 X:76353528-76353550 CACAGACCCTTTGAAGAAACTGG + Intergenic
1192991868 X:76467852-76467874 CACAGACTTTTTGAAGGAGGTGG - Intergenic
1192995266 X:76506164-76506186 CACAGACCCTATGAAGGAAGTGG - Intergenic
1192995338 X:76506624-76506646 CACAGACCCTTTGAAGAAATTGG - Intergenic
1193057552 X:77169240-77169262 CACAGACCTTTTGAAGGAGCTGG - Intergenic
1193076882 X:77364301-77364323 CACAGAACCTCTGAAGGAAATGG + Intergenic
1193185440 X:78507100-78507122 CACAGACTCTTGGAAAGAAGTGG + Intergenic
1193196887 X:78643240-78643262 CACAGACCCTTTGAAGGAGGTGG + Intergenic
1193250948 X:79290188-79290210 CACTAACCCTTTGAAAGAACTGG + Intergenic
1193315115 X:80055878-80055900 CACAGACCCTTTGAAAGAAGTGG - Intergenic
1193366309 X:80637944-80637966 CACAGACCCTTTGAAGGAACTGG + Intergenic
1193382660 X:80833968-80833990 CACAGACCCTTTGAAAGAAGAGG + Intergenic
1193420673 X:81279445-81279467 CACAGACCCTCTCAAGGAAGTGG + Intronic
1193447590 X:81622597-81622619 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1193469938 X:81887781-81887803 CACAGACCCCTTGAAGGAGATGG - Intergenic
1193556417 X:82959874-82959896 CACAGATCTTTTGAAAGAAGTGG + Intergenic
1193631773 X:83898760-83898782 CACAGACCCTTTGATGGAAGTGG + Intergenic
1193723850 X:85017902-85017924 CACAGATCCTTTGATGGTAGTGG - Intronic
1193791524 X:85821137-85821159 CACAGACTCTCTGAAGAAAGTGG + Intergenic
1193937062 X:87636478-87636500 CACAGACCCTCTGAGGGAGGTGG + Intronic
1194053516 X:89101522-89101544 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1194058397 X:89165559-89165581 CACAGACCCACTGAAAGAAGTGG + Intergenic
1194075484 X:89386618-89386640 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1194076564 X:89400937-89400959 CACAGACCCTTTGAAAGAAGTGG - Intergenic
1194165244 X:90507436-90507458 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1194299223 X:92163715-92163737 CACAGACCCTCTGAAGGAAGTGG - Intronic
1194380867 X:93190529-93190551 CACAGACCCTTTGAAGGAACTGG + Intergenic
1194466314 X:94238298-94238320 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1194491933 X:94561268-94561290 CACAGACCCTTTGAAAAAAGTGG - Intergenic
1194515865 X:94853930-94853952 CAGAGACCCTTTGAAGGAAGAGG + Intergenic
1194601170 X:95923572-95923594 CAAAGACCTTTTGAAGGAACTGG + Intergenic
1194605565 X:95974535-95974557 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1194701626 X:97120409-97120431 CACAGACCCTCTGAAGGAAGGGG - Intronic
1194834531 X:98665530-98665552 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1194881794 X:99261343-99261365 CACAGAGCCTTTGAAGGAAGTGG - Intergenic
1194927047 X:99837235-99837257 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1194932296 X:99902086-99902108 CACAGACCCTCTGAAGGAAGTGG - Intergenic
1195237031 X:102910977-102910999 CACAGACCCTTTGAAGAAACTGG + Intergenic
1195734110 X:107995804-107995826 CACAGACCCTTTGAAAGAAGTGG + Intergenic
1195795317 X:108641501-108641523 CACAGACCCTCTGAAGGAAGTGG + Intronic
1195817191 X:108902122-108902144 CACAGATCCTTTGAAAGAAGTGG + Intergenic
1195985257 X:110622202-110622224 CACAGACCCTTTGAAGGAAGTGG - Intergenic
1196023955 X:111020650-111020672 CACAGACCCTTTGAAGGAACTGG + Intronic
1196170775 X:112586897-112586919 CACAGACCCTCTGAAAAAAGCGG + Intergenic
1196231950 X:113233971-113233993 CACAGACCCTTTGAAGGAACTGG - Intergenic
1196235397 X:113274186-113274208 CACAGACCCTCTGAAGGAAGCGG + Intergenic
1196519429 X:116655317-116655339 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1196737428 X:118992191-118992213 CACAGTCCCTCTGAAGGAAGCGG + Intronic
1196948950 X:120856982-120857004 CACAGACCATTTGAAGGAACTGG + Intergenic
1197009515 X:121544508-121544530 GACAGACCCTTTGAAAGAAGTGG + Intergenic
1197034712 X:121859673-121859695 CACAGACACTTTGAAGGACCTGG - Intergenic
1197066360 X:122237959-122237981 CACAGACCCTCTGAAGGAAGCGG - Intergenic
1197081816 X:122426784-122426806 CACAGACCCTTTGAAGGAACTGG - Intergenic
1197102521 X:122673226-122673248 CACAGACCCTCTGAAGGAAACGG + Intergenic
1197137832 X:123083527-123083549 CACAGACCCCTTGAAGACAAGGG + Intergenic
1197472298 X:126878382-126878404 CACAGATCCTTTGAAAGCAGTGG - Intergenic
1197515574 X:127423301-127423323 CTCAGACCCTTTGAAGGAACTGG - Intergenic
1197545141 X:127815444-127815466 CACAGACCCTGTGAAGGAGGTGG + Intergenic
1197588786 X:128383527-128383549 CACAGACCCTCTGAAGGAAGTGG + Intergenic
1197603613 X:128559861-128559883 CACAGATTCTTTGAAAGAAGTGG + Intergenic
1197669089 X:129255948-129255970 CACAGACCCGCTGAAGGAAGGGG - Intergenic
1197830115 X:130632637-130632659 CACAAACCCTTAGAAGGGACAGG + Intronic
1197953563 X:131923178-131923200 CACAGACGCTCTGAAGGAAGCGG + Intergenic
1198604606 X:138322796-138322818 CACAGACTCTTTGAAGGATCTGG - Intergenic
1198664683 X:139007799-139007821 CACAGACCCTTTGAAGGAACTGG + Intronic
1198797335 X:140410930-140410952 CACAGACCCTTTGAAGGAGGTGG - Intergenic
1198836954 X:140815822-140815844 CACAGCCCCTGTGAAGGATGGGG + Intergenic
1198837074 X:140816604-140816626 TACAGATCCTTTGAAAGAAGTGG - Intergenic
1198843100 X:140880307-140880329 CACAGACTCTATGAAGGAAGTGG + Intergenic
1198929434 X:141837679-141837701 CACAGACCCTTTGAATGAAGTGG - Intergenic
1198943389 X:141982967-141982989 CACAGATCCTTTCGAGGAAGTGG - Intergenic
1199015013 X:142804757-142804779 CACAGACCCTTTGAAGAAACTGG - Intergenic
1199121538 X:144060622-144060644 CACAGACCTTTTGAAGGAACTGG + Intergenic
1199170053 X:144725385-144725407 AACAGACCCTTTGTAAGAAGTGG + Intergenic
1199298729 X:146187764-146187786 CACAGACCCTTTGAAAGAAGTGG - Intergenic
1199321854 X:146448925-146448947 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1199586714 X:149422899-149422921 CACAGATGCTTTGAAAGAAGTGG + Intergenic
1200332625 X:155313685-155313707 CACAGACCCTTTGAAGGAACTGG + Intronic
1200429205 Y:3056457-3056479 CACAGACCCTTTGAAAGAAGTGG - Intergenic
1200511508 Y:4085246-4085268 CACAGACCCTTTGAAGGAAGTGG + Intergenic
1200616827 Y:5388549-5388571 CACAGACCCTCTGAAGGAAGTGG - Intronic
1200731085 Y:6740779-6740801 CACAGATCCTTTGAAAGAAGTGG - Intergenic
1202043606 Y:20713931-20713953 CACAGATTCTCTGAAGGAAGTGG + Intergenic