ID: 937699496

View in Genome Browser
Species Human (GRCh38)
Location 2:124847613-124847635
Sequence AGAACCCACAGACCCTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937699496_937699497 -9 Left 937699496 2:124847613-124847635 CCTTCAAAGGGTCTGTGGGTTCT No data
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699496_937699498 4 Left 937699496 2:124847613-124847635 CCTTCAAAGGGTCTGTGGGTTCT No data
Right 937699498 2:124847640-124847662 GCTTTCCTGGTACGTTCCTGTGG No data
937699496_937699500 14 Left 937699496 2:124847613-124847635 CCTTCAAAGGGTCTGTGGGTTCT No data
Right 937699500 2:124847650-124847672 TACGTTCCTGTGGTAGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937699496 Original CRISPR AGAACCCACAGACCCTTTGA AGG (reversed) Intronic
No off target data available for this crispr