ID: 937699497

View in Genome Browser
Species Human (GRCh38)
Location 2:124847627-124847649
Sequence GTGGGTTCTCTTAGCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937699493_937699497 -3 Left 937699493 2:124847607-124847629 CCAGTTCCTTCAAAGGGTCTGTG 0: 47
1: 97
2: 297
3: 298
4: 336
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699490_937699497 11 Left 937699490 2:124847593-124847615 CCTGCAGTGGTGATCCAGTTCCT 0: 19
1: 20
2: 55
3: 56
4: 171
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699496_937699497 -9 Left 937699496 2:124847613-124847635 CCTTCAAAGGGTCTGTGGGTTCT No data
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data
937699489_937699497 12 Left 937699489 2:124847592-124847614 CCCTGCAGTGGTGATCCAGTTCC No data
Right 937699497 2:124847627-124847649 GTGGGTTCTCTTAGCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937699497 Original CRISPR GTGGGTTCTCTTAGCTTTCC TGG Intronic
No off target data available for this crispr