ID: 937701258

View in Genome Browser
Species Human (GRCh38)
Location 2:124865608-124865630
Sequence ATGCTGATACTGGTGGGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 375}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937701258_937701266 11 Left 937701258 2:124865608-124865630 CCATGTCCCACCAGTATCAGCAT 0: 1
1: 0
2: 3
3: 43
4: 375
Right 937701266 2:124865642-124865664 CTGTTAGAAATGCAGATTCTTGG No data
937701258_937701267 12 Left 937701258 2:124865608-124865630 CCATGTCCCACCAGTATCAGCAT 0: 1
1: 0
2: 3
3: 43
4: 375
Right 937701267 2:124865643-124865665 TGTTAGAAATGCAGATTCTTGGG 0: 32
1: 230
2: 869
3: 1949
4: 3121
937701258_937701268 22 Left 937701258 2:124865608-124865630 CCATGTCCCACCAGTATCAGCAT 0: 1
1: 0
2: 3
3: 43
4: 375
Right 937701268 2:124865653-124865675 GCAGATTCTTGGGCCAAGTGTGG No data
937701258_937701269 25 Left 937701258 2:124865608-124865630 CCATGTCCCACCAGTATCAGCAT 0: 1
1: 0
2: 3
3: 43
4: 375
Right 937701269 2:124865656-124865678 GATTCTTGGGCCAAGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937701258 Original CRISPR ATGCTGATACTGGTGGGACA TGG (reversed) Intronic
902176938 1:14657485-14657507 ATGCTGATGCTAGTGGCCCAGGG + Intronic
902271889 1:15310581-15310603 ATGCTGATGCTGCTGGTCCAGGG - Intronic
902420424 1:16274970-16274992 ATGTTCATACTGGTGTCACATGG + Intronic
903384744 1:22918995-22919017 ATTCTGATACAGGTGGGCGATGG - Intergenic
903413420 1:23165755-23165777 ATGCTGTTACAGGTAGGACCCGG - Intronic
904126086 1:28240299-28240321 ATGCTGACACTGCTGGCTCATGG - Intronic
904975229 1:34451092-34451114 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
905393134 1:37650871-37650893 ATGCCCATACTGGAGGGCCAGGG + Intergenic
905529204 1:38663263-38663285 ATGGTGGTAATGGTGGGATAAGG - Intergenic
905890487 1:41515875-41515897 CTGCTGAGACTGGGGGGACAGGG - Intronic
906132891 1:43471837-43471859 ATGCTGATGCTGTTGGTCCAGGG + Intergenic
906490743 1:46266639-46266661 GTGAGGATTCTGGTGGGACATGG + Intronic
906654938 1:47541316-47541338 AGGCTGATGCAGGTGGGAGAAGG + Intergenic
906864333 1:49400047-49400069 ATGATGAGACTGGTGAGATATGG + Intronic
907748416 1:57238162-57238184 ATGCTGATACTGCTGGCCCAAGG - Intronic
908188234 1:61673215-61673237 ATCTTGATAGTGGTGGGAGAGGG + Intergenic
909566213 1:77056146-77056168 ATGCTGTTTCTGGTGCAACATGG - Intronic
909968114 1:81943641-81943663 ATACTGATACTGGTTGGGGAAGG - Exonic
911072062 1:93839967-93839989 ATGCTGATACTCCTGGTTCATGG + Intronic
911524442 1:98966881-98966903 TTGCTGATACTGTTGGTTCAGGG - Intronic
912324041 1:108740984-108741006 ATGCTGATACTTTTGGCACCAGG - Intronic
913522303 1:119656389-119656411 ATGCTGTGAAAGGTGGGACAGGG + Intergenic
915122998 1:153643677-153643699 GTGGTGATGGTGGTGGGACAGGG - Intronic
916496700 1:165354180-165354202 GTGTTGGTACTGGGGGGACAAGG - Intronic
916968128 1:169975889-169975911 ATGTTGATAATGGTGCAACAGGG - Intronic
917672676 1:177287853-177287875 ATGCTGATGCTGCTGGTCCATGG + Intergenic
918247546 1:182672907-182672929 ATGCTGACACTGCTGGTTCAGGG - Exonic
918594667 1:186279185-186279207 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
919128429 1:193425217-193425239 ATTCTGATACTGGTGGTATAGGG - Intergenic
920384744 1:205563025-205563047 ATGCTGCTGCTGGTGGTCCAGGG + Intergenic
920763634 1:208810115-208810137 ATGCTGATGCTGCTGGTTCAGGG + Intergenic
922033091 1:221823362-221823384 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
922034539 1:221835643-221835665 ATTCTGATGCTGGTGGTCCAGGG - Intergenic
922652681 1:227354823-227354845 ATAGTGATCCTGGAGGGACAAGG - Intergenic
1063515678 10:6692707-6692729 ATGCTGATGCTGCTGGTTCAGGG + Intergenic
1063815768 10:9769487-9769509 ATACAGATAATGGTGGAACAGGG + Intergenic
1064574635 10:16731886-16731908 AAGCCGATATTGTTGGGACAGGG + Intronic
1064925186 10:20561917-20561939 ATGCTGATGCTGTTGGTCCATGG + Intergenic
1064941965 10:20745358-20745380 ATGCTGATGCTGCTGGTTCATGG - Intergenic
1065111109 10:22440657-22440679 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1065389681 10:25169867-25169889 ATGCTAATACTGCTGGCCCAGGG - Intergenic
1065415973 10:25486680-25486702 ATGCTGATGCTGTTGGTCCATGG + Intronic
1066604535 10:37148167-37148189 ATGCTGATACCAGTGGTACTTGG + Intronic
1066604851 10:37154379-37154401 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066605332 10:37161149-37161171 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066606392 10:37178473-37178495 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066607174 10:37190274-37190296 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1066608266 10:37205854-37205876 ATGCTGATGCTGGTGGTTCTTGG + Intronic
1067791643 10:49292885-49292907 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1068730046 10:60347843-60347865 ATGCTGATTCTGTTGGCTCAGGG + Intronic
1070644234 10:78190411-78190433 ATGGTGAGACAGGTGGGACCAGG - Intergenic
1071120365 10:82269824-82269846 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1071460294 10:85887462-85887484 ATGCTGATACTGTTGGCCCATGG - Intronic
1071901470 10:90124813-90124835 ATGCAGACACTGGTGGGGAAAGG - Intergenic
1072096026 10:92180793-92180815 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1072438883 10:95436841-95436863 ATGCTGAAGCTGGAGTGACAAGG - Intronic
1074143299 10:110695995-110696017 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1074310828 10:112321953-112321975 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1075070666 10:119318032-119318054 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1075224843 10:120619110-120619132 ATGCTGATGCTGCTGGGTCCAGG + Intergenic
1077987890 11:7373676-7373698 AGGTTGAAACTGGTGGGATATGG - Intronic
1078252211 11:9625539-9625561 ATTCTGATACTGCTGGTCCAGGG + Intergenic
1079015998 11:16869267-16869289 ATTTTGATACTGGTGGTCCATGG - Intronic
1080249326 11:30215317-30215339 ATGCTGATCCTGCTGGCCCAGGG + Intergenic
1080757389 11:35215150-35215172 ATACTGACACTGCTGGGACAGGG + Intronic
1080998338 11:37633967-37633989 AGGCTGATACTTATGGGAAATGG - Intergenic
1081099743 11:38986827-38986849 ATGCTGTTACTGCTGGGATGAGG - Intergenic
1083977854 11:66138409-66138431 ATGCTGATGCTGATGGTCCATGG + Intronic
1087025716 11:93647532-93647554 ATGCTGATACTGATGGTCCACGG - Intergenic
1087367342 11:97237343-97237365 ATGCTCATACTGGTTAGAAAGGG - Intergenic
1087431643 11:98063898-98063920 ATTCTGATACTGTGGGGTCATGG - Intergenic
1087767675 11:102174081-102174103 ATGCTGATACTGCTGGTTAAAGG + Intronic
1088574040 11:111252413-111252435 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1089135097 11:116242622-116242644 AGGCAGATACTGGAGCGACATGG + Intergenic
1089947598 11:122493721-122493743 ATGCTGATGCTGCTGATACATGG - Intergenic
1090399419 11:126439524-126439546 ATGCAGATACTGGCTGGGCATGG + Intronic
1091841516 12:3624736-3624758 AGGCTGATGCTGGTGGTCCAGGG - Intronic
1092378452 12:7975256-7975278 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1093672042 12:21888512-21888534 ATGCTGATGCTGGTGGTCCTTGG - Intronic
1093746167 12:22742945-22742967 ATGCTAATACTGCTGGTTCATGG - Intergenic
1095367301 12:41422971-41422993 ATGCTGATTCTGGTTTTACATGG + Intronic
1095514512 12:42991125-42991147 ATGCTGATACTCTTAGGGCAGGG + Intergenic
1095585708 12:43847137-43847159 CTGCTGATATTTGTGGGAGAAGG + Intronic
1096588449 12:52641445-52641467 ATTCTGATGCTGGTGACACAAGG - Intergenic
1097399401 12:59110545-59110567 ATGGTGCTACAGGAGGGACAGGG + Intergenic
1098633505 12:72753538-72753560 ATGCTGACACTGGATGGAAATGG - Intergenic
1098806885 12:75032142-75032164 AGGCTGATACTGCTGGGAGTTGG - Intergenic
1101473812 12:105024724-105024746 ATGCTGATGCTAGTGGTCCATGG + Intronic
1101706718 12:107227405-107227427 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1101916439 12:108899719-108899741 ATGTTGATAATGGTGTGACTGGG + Intronic
1102202271 12:111065759-111065781 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1102751768 12:115300795-115300817 GTGCTGATGCTGCTGGGCCAAGG + Intergenic
1103015924 12:117494471-117494493 ATGCTGATGCTGGGGGTCCAGGG + Intronic
1103065004 12:117890109-117890131 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1104794692 12:131509336-131509358 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1105054202 12:133081851-133081873 ATGCTGATACTGCTGGTCCAAGG - Intronic
1105842625 13:24268012-24268034 ATGCTGATACTGCTGGTCCATGG + Intronic
1107007601 13:35632325-35632347 ATGCTGATTCTGCTGGGTTATGG - Intronic
1108003316 13:45924201-45924223 ATGCTGATACTGTTGGTCCCGGG - Intergenic
1108016558 13:46082804-46082826 ATGTTGGTAATGGTGGGAAACGG - Intronic
1108095112 13:46893404-46893426 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1108382687 13:49869234-49869256 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1110416265 13:75256541-75256563 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1110872977 13:80474336-80474358 ATGTTGTTGCTGGTGGTACATGG - Intergenic
1111281737 13:86034542-86034564 ATGCTTATACTGGTGGTCCATGG + Intergenic
1111638890 13:90942266-90942288 ATGTTGAGACTGGTGGACCAGGG - Intergenic
1112365999 13:98756000-98756022 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1112900705 13:104353879-104353901 ATGCTGAGAGTGGTGGGGAAGGG + Intergenic
1116056475 14:39870591-39870613 ATGCTGAGAGAAGTGGGACAGGG + Intergenic
1116486316 14:45453147-45453169 AGGCTGTCACTGCTGGGACAGGG - Intergenic
1117107185 14:52409945-52409967 ATGTTGATACTGTTGGTCCATGG - Intergenic
1117455275 14:55890676-55890698 ACACTGATACTGGAGGGATAGGG + Intergenic
1117584061 14:57182118-57182140 ATGCTGATACTGCTTGGCCTGGG + Intergenic
1118150241 14:63181253-63181275 ATGCTGATGTTGGTGGTTCATGG - Intergenic
1118867763 14:69716934-69716956 TTGCTGAAGATGGTGGGACAGGG - Intergenic
1118959283 14:70514078-70514100 ATGCAGAGACTGGGGAGACAGGG - Intergenic
1119433351 14:74582729-74582751 ATGCTGATGCTACTGGGCCACGG - Intronic
1119499838 14:75115717-75115739 ATGCTGATGCTGCTGGTCCATGG - Intronic
1119767824 14:77201550-77201572 ATGCTGATGCCGCTGGGCCAGGG - Intronic
1119924447 14:78479441-78479463 ATGCTGATACTGCTGGTTCTGGG + Intronic
1121469272 14:94139308-94139330 ATGCTGACACTGCTGGTCCATGG + Intergenic
1122686438 14:103510088-103510110 ATGCTGACGTTGGTGTGACAGGG - Intergenic
1202847386 14_GL000009v2_random:192266-192288 ATGCTGATGCTGCTAGCACAGGG + Intergenic
1123885081 15:24718573-24718595 CTGCTTCTTCTGGTGGGACATGG - Intergenic
1124029351 15:25995331-25995353 ATGCTGGTACTGCTGGTACATGG + Intergenic
1125774694 15:42201646-42201668 ATGCTGATGCTGGTGGTTCAAGG + Intronic
1126924063 15:53562492-53562514 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1128691977 15:69731564-69731586 ATGCTGATACAGTCGGTACAGGG + Intergenic
1128850235 15:70947631-70947653 ATGCTAATACTGCTGGTTCAAGG - Intronic
1128941011 15:71787643-71787665 ATGCTGATGCTGCTGGTCCAAGG + Intergenic
1129032182 15:72627502-72627524 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129113951 15:73354523-73354545 ATGCTGAGACTGCTGGTGCAGGG + Intronic
1129217715 15:74109737-74109759 ATGCTGATGCTGTTGGCCCAGGG + Intronic
1129470154 15:75749110-75749132 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1129734876 15:77954032-77954054 ATGCTGATGCTGCTGGCTCAGGG + Intergenic
1129840715 15:78741959-78741981 ATGCTGATGCTGCTGGCTCAGGG - Intergenic
1130430962 15:83846467-83846489 AGGCTTAGAGTGGTGGGACAGGG + Intronic
1130771178 15:86925341-86925363 ATGCTGATACTGCTGGTCCAAGG + Intronic
1131670055 15:94610340-94610362 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1133907528 16:10035665-10035687 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1133911513 16:10070309-10070331 ATGCTGATGCTGCTGGCCCATGG - Intronic
1133985391 16:10664446-10664468 ATGCTGATGCTGATGGTCCAAGG + Intronic
1133997114 16:10756851-10756873 AGGCTGAGACTGGCAGGACAGGG - Intronic
1134419799 16:14075607-14075629 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1135046318 16:19158913-19158935 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1135987628 16:27195635-27195657 ATGCTCCTGCTGGTGGTACAAGG - Intergenic
1137524299 16:49220741-49220763 TTGATGATGCTGGTGGGAGAGGG + Intergenic
1137658106 16:50178636-50178658 ATGCTGACACTGCTGTAACATGG + Intronic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139498699 16:67342460-67342482 ATTCTGATGATGGTGGTACATGG + Intronic
1139683310 16:68582109-68582131 ATGTTGATACTGCTGGCCCAGGG + Intergenic
1139959817 16:70711054-70711076 ATGAGGACACTGATGGGACAGGG - Intronic
1140525225 16:75617434-75617456 ATGCTGATGCTGCTGGTACAGGG - Intronic
1143949373 17:10620570-10620592 ATACTGATGCTGGTGGTCCAGGG - Intergenic
1144088587 17:11833067-11833089 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144099389 17:11930585-11930607 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1144138078 17:12318409-12318431 ATGCTGATATTGCTGGTCCAAGG - Intergenic
1144194243 17:12875213-12875235 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1144337458 17:14284466-14284488 ATGCTAATACTGCTGGTCCAAGG + Intergenic
1146639615 17:34530483-34530505 ATACTAATACTGCTGGGCCATGG + Intergenic
1147997109 17:44366250-44366272 ATGCTGTTACTGTTGGCCCAGGG + Intergenic
1148756470 17:49975706-49975728 CTGCTGATCCTGGTGGGAGCAGG - Intergenic
1149026786 17:52036109-52036131 ATGTTGATGCTGCTGGGCCAGGG + Intronic
1149067116 17:52494081-52494103 ATGCTGACACTGTTGGTTCATGG + Intergenic
1149508987 17:57221602-57221624 ATGCTGATAGTGGGGGGAGGGGG + Intergenic
1151999292 17:77635321-77635343 CCTCTGGTACTGGTGGGACATGG - Intergenic
1152881428 17:82818269-82818291 ATTCTGTTCCTGGTGGGACATGG + Intronic
1153225953 18:2900020-2900042 ATGGTGAAACTCGTGGGATAGGG - Intronic
1153555595 18:6310081-6310103 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1153689131 18:7573918-7573940 ATGCTGATGCTGCTGGCTCAAGG - Intronic
1153776492 18:8458759-8458781 ATGCTGATACTGCTGGGTCTGGG - Intergenic
1154336684 18:13471570-13471592 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1154477587 18:14778760-14778782 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1154480251 18:14815429-14815451 ATGCTGATGCTGGTGGTCCTTGG + Intronic
1155981969 18:32189488-32189510 AAGCAAACACTGGTGGGACATGG - Intronic
1156367183 18:36440169-36440191 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1157433960 18:47653114-47653136 ATGCTGGAAATGGTGGGCCATGG + Intergenic
1157471781 18:47994408-47994430 GTGCTGATGCTGCAGGGACAGGG + Intergenic
1157490301 18:48119161-48119183 ATGCTGATGCTGTTGGTTCAGGG + Intronic
1157710435 18:49846357-49846379 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1162005970 19:7779537-7779559 TGCCTGATACTGGTGGGATAAGG - Intergenic
1162782897 19:13015937-13015959 TTGATGATACTGGTGTGACAAGG + Intronic
1163330917 19:16637179-16637201 ATGCTAATACTGCTGGTCCACGG - Intronic
1163654063 19:18535446-18535468 ATGCTGGTGCTGATGGGAGATGG + Intronic
1165393312 19:35550489-35550511 AAGCAGATACTGGTGGGGCTGGG + Exonic
1165908795 19:39211010-39211032 ATGCTGATGCTGTTGGTCCAGGG - Intergenic
1166571377 19:43799029-43799051 ACGCTGAGACTGGAGGGAGAAGG - Intronic
925866471 2:8232377-8232399 ATGCTGGAACTGGTGGGACAGGG - Intergenic
926768828 2:16350021-16350043 TTGCTGATACTGCTGGTCCAGGG + Intergenic
927290634 2:21401745-21401767 ATGCTGATACTGCTGGTTCAAGG + Intergenic
928246936 2:29638538-29638560 ATGCGGATAATGCTGGGGCAGGG + Intronic
929006296 2:37396645-37396667 ATGCTGATTCTGGCAGGGCACGG + Intergenic
929054261 2:37862625-37862647 CTGCTGAGACTGGAGGAACATGG + Intergenic
929321585 2:40550265-40550287 ATGCAGATGCTGGTGGGGAAAGG + Intronic
929615487 2:43303935-43303957 ATGCTGATGCTGCTGGGGCAGGG + Intronic
930527942 2:52554750-52554772 ATGCTGATATTGCTGGTCCAGGG - Intergenic
930804742 2:55479161-55479183 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
931044945 2:58341115-58341137 CTGCTGCTGGTGGTGGGACAAGG - Intergenic
932042655 2:68317747-68317769 ATGCTGATACTGCTGGTCCAGGG - Intronic
932416745 2:71578200-71578222 ATGCTGATGCTGCTGGTCCAGGG + Intronic
932972368 2:76560113-76560135 ATGGTAGTAGTGGTGGGACATGG - Intergenic
933196593 2:79397054-79397076 ATGCTGACACTGCTGGTCCAGGG + Intronic
933600284 2:84321937-84321959 ATGCTGATGCTGCTGGGCCATGG + Intergenic
933832406 2:86221658-86221680 ATCCTGAGACTGGGGGGCCATGG + Intronic
933891845 2:86779027-86779049 ATGCTGATGCTGCTGGTCCATGG - Intergenic
934537568 2:95148306-95148328 ATGCTGTTACTGACGGGGCAGGG - Exonic
935203995 2:100881981-100882003 ATGCTGAAACTGCTGGGGCTGGG + Intronic
935557493 2:104526258-104526280 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
935619073 2:105113060-105113082 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
936652761 2:114448492-114448514 ATGCTGATACTGCTGGTCTAGGG - Intronic
937248851 2:120510971-120510993 CTGGTGCTACTGGTGGGATATGG + Intergenic
937701258 2:124865608-124865630 ATGCTGATACTGGTGGGACATGG - Intronic
939220999 2:139301471-139301493 ATGCTGATAATGCTGGATCAAGG - Intergenic
939848685 2:147278510-147278532 ATGCTGATACTGCTAGTTCAGGG + Intergenic
941746761 2:169095196-169095218 ATGCTGATGCTGCTGGTCCAGGG - Intronic
942838344 2:180328974-180328996 ATGCTGCTACTGCTGGGGGATGG - Intergenic
943268077 2:185763128-185763150 AAGCTGATATTGCTGGGACAAGG - Intronic
943590750 2:189793376-189793398 ATGCTGATGCTGGTGGGTTATGG + Intronic
943598360 2:189884846-189884868 ATGCTGATGCTGCTGGTTCAGGG + Intronic
944658979 2:201904674-201904696 ATGCTGATGTTGCTGGTACAGGG - Intergenic
945435825 2:209816631-209816653 ATGCTGATGCTGCTGGTCCAGGG + Intronic
945446254 2:209941738-209941760 ATGCTGATGCTGCTGGCCCAGGG - Intronic
947861093 2:233357867-233357889 ATGCTGATGCTGCTGGTCCATGG + Intronic
948738752 2:240028893-240028915 CTGCTGGGACAGGTGGGACAGGG + Intergenic
948812993 2:240494523-240494545 AAGCTGTCACTGCTGGGACAGGG - Intronic
1168850203 20:971325-971347 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1169675354 20:8147132-8147154 ATGCTGATGCTGTTGGTCCAGGG - Intronic
1169797427 20:9478773-9478795 ATGCTGATGCTGCTTGTACATGG + Intronic
1170040445 20:12034544-12034566 ATGCTGATTCTGTTGGTCCATGG + Intergenic
1170096720 20:12653314-12653336 ATGCTGACACTGCTGGCCCAAGG + Intergenic
1170364734 20:15586311-15586333 ATGCTAATACTGCTGGCCCAGGG + Intronic
1170412284 20:16104625-16104647 ATGCTGATACTGCTGGGCAAGGG - Intergenic
1170784974 20:19460006-19460028 ATGCTGATACTGCTGGCCCGTGG + Intronic
1171318489 20:24217699-24217721 CTGCTGACACTTGTGGCACATGG - Intergenic
1171377675 20:24704491-24704513 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1171964557 20:31519555-31519577 ATGCTGACACTGCTGGCCCAGGG - Intronic
1172678404 20:36692512-36692534 ATGTTGATTCTTGTGGGGCACGG - Intronic
1172976818 20:38912329-38912351 ATGCTGATGTTGCTGGTACAGGG - Intronic
1173451842 20:43171773-43171795 ATGCTGACACTGCTGGTCCAGGG + Intronic
1174483588 20:50847750-50847772 ATTCAGTTACAGGTGGGACACGG + Intronic
1174530892 20:51213070-51213092 ATGCTGATGCTGTTGGTACAGGG + Intergenic
1176800293 21:13420860-13420882 ATGCTGATGCTGGTGGTCCTTGG - Intergenic
1177197427 21:17918119-17918141 AGGCTGATACTGGTGGGGTATGG + Intronic
1177423557 21:20893968-20893990 TAGCTGATCCTGGTGGTACATGG - Intergenic
1177536821 21:22439183-22439205 ACGCTGATACTGCTGGTTCATGG - Intergenic
1178415413 21:32400904-32400926 ATGCAGAGCCTGGTTGGACAAGG + Intergenic
1178454518 21:32735739-32735761 ATGCTGATACTGCTGGTCCAGGG + Intronic
1178765021 21:35442274-35442296 ATGCTGACACTGCTGGTGCAGGG + Intronic
1180000780 21:44994449-44994471 ATGCTGAGACTGGGGCTACATGG + Intergenic
1181825384 22:25511136-25511158 ATTCTGATACTGATGGTCCAGGG + Intergenic
1181856787 22:25787408-25787430 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1181867525 22:25870684-25870706 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1181913165 22:26256682-26256704 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1183093110 22:35536838-35536860 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1183161444 22:36116104-36116126 ATGCTGATACTTTTGGGGAAAGG + Intergenic
1184268619 22:43364527-43364549 ATGATGATAATGGTAGGACCTGG + Intergenic
1184277452 22:43418214-43418236 ATGCTGGTAATAGTGGCACAGGG + Intronic
949276306 3:2286780-2286802 ATGCTTAAAATGTTGGGACATGG + Intronic
949830002 3:8204117-8204139 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
949961712 3:9317773-9317795 ATGCTGATGCTGCTGGTCCAGGG + Intronic
950010096 3:9716879-9716901 ATGCTGATGCTGCTGGCTCATGG - Intronic
950021493 3:9791160-9791182 ATGCTGAGACTTGGGGTACAGGG - Intronic
950652080 3:14413512-14413534 ATGCCCATACTGCTGGGCCAGGG - Intronic
950892929 3:16420926-16420948 ATGCTGATGCTGCTGGTGCATGG + Intronic
951471886 3:23065277-23065299 ATGCTGATGCTGTTGGCACGTGG - Intergenic
951689572 3:25381704-25381726 ATGCTGATGCTGCTGGTCCAAGG - Intronic
951766365 3:26204066-26204088 ATGCTGATGCTGTTGGACCAGGG + Intergenic
952329635 3:32352376-32352398 ATGCTGATGCTGCTGGCTCAGGG - Intronic
952427297 3:33188587-33188609 ATGTTGAGACTGCTGGTACAAGG + Intronic
952742359 3:36746927-36746949 ATGCTGATGCTGTTGGGCCCTGG + Intergenic
955531157 3:59874511-59874533 ATGCTGATGCTGCTGGTCCAGGG + Intronic
956988122 3:74728319-74728341 ATGCTGACACTGCTGGTTCATGG + Intergenic
957015504 3:75059484-75059506 ATCCTGATACTGCTGGATCATGG - Intergenic
957103683 3:75859203-75859225 ATGCTGATGCTGCTAGCACAGGG + Intergenic
958428622 3:94009995-94010017 ATGCTGATGCAGGTGGTCCATGG - Intronic
958882737 3:99691471-99691493 ATGCTGATGCTGCTGGTCCATGG - Intronic
960171095 3:114461701-114461723 ATGCTGATGCTGCTGGCCCAAGG - Intronic
960315030 3:116166030-116166052 ATGCTAATTGTGGTGGGCCAGGG + Intronic
962875313 3:139531588-139531610 ATGCTGATGCTGTTGGTTCAAGG - Intronic
962942676 3:140140139-140140161 ATGCTGATGCTGATGGTCCAGGG + Intronic
963346686 3:144103385-144103407 ATGCTGACACTGCTGGTCCAGGG + Intergenic
964621186 3:158721434-158721456 ATGCTGATCCTGTTGGTCCAGGG + Intronic
965507466 3:169532272-169532294 ATGCTGATGCTGCTGGCCCAGGG + Intronic
965513437 3:169594404-169594426 ATGCTGATACTGCTAGTCCAGGG - Intronic
965641006 3:170829018-170829040 ATGCTGATGCTGCTGGTCCAGGG - Intronic
966402850 3:179564052-179564074 ATGCTGACACTGCTGGTCCATGG - Intronic
966600807 3:181773385-181773407 ATGGTGAGAATGGTGGGAGATGG + Intergenic
967113196 3:186313571-186313593 ATGCTGATGCTGCTGGTCCAGGG - Intronic
967874640 3:194259272-194259294 ATGCTGATGCTGCTGGCCCATGG + Intergenic
968540282 4:1164796-1164818 ATGCTGACCCAGTTGGGACAAGG + Intergenic
968905102 4:3447323-3447345 CTGTTGATACTGGGGAGACAGGG - Intronic
969305409 4:6323585-6323607 ATGATGACGCTGGTGGGAGAAGG + Exonic
969954726 4:10877168-10877190 ATGCTGATGCTGCTGGCCCAAGG - Intergenic
970019834 4:11555596-11555618 ATGCTGATACTGTTAGTCCATGG + Intergenic
970778286 4:19703943-19703965 AGGATGATACTGGTGGCCCATGG + Intergenic
971464476 4:26940945-26940967 GTGCTGATACTGCTGGTCCAGGG + Intronic
971759001 4:30739579-30739601 ATGCTTATACTGTTAGGTCAAGG + Intronic
972057495 4:34822594-34822616 ACAGAGATACTGGTGGGACAAGG + Intergenic
973869283 4:55148844-55148866 ATGCTAATGCTGCTGGTACATGG + Intergenic
973872215 4:55177952-55177974 ATGCTGAGGCTGGGGTGACAGGG - Intergenic
974780030 4:66543139-66543161 ATGTTGACACTGCTGGGGCATGG - Intergenic
976164713 4:82242014-82242036 ATGCTGATGCTGATGGCCCAAGG - Intergenic
976671262 4:87656785-87656807 ATGCTGATGCTGGTGGTTCCAGG - Intronic
977418438 4:96764643-96764665 ATGCTGAGACTGTTGGAACCCGG + Intergenic
978588198 4:110295224-110295246 GTGCTGATTCTGGTGGAGCAAGG - Intergenic
978747735 4:112212849-112212871 ATGCTGCTACTGATCTGACAGGG + Intergenic
979147744 4:117266602-117266624 ATGCCAAAACTGGTGAGACAAGG - Intergenic
981195211 4:141911762-141911784 ATACAGAGACTGGTGGGACCAGG - Intergenic
982716354 4:158812667-158812689 ATGTTGATACTGTGGGGGCAAGG - Intronic
983905507 4:173177229-173177251 ATGCTGATGCTGCTGGTCCAGGG + Intronic
983935321 4:173498992-173499014 ATCCTGATGCTGGTGGGGGAAGG - Intergenic
987025332 5:13921277-13921299 ATGCTGATCCTGCTGGGATTGGG - Intronic
988709451 5:33758796-33758818 ATTCAGATACTGGTGGGATAAGG + Intronic
991041570 5:62181231-62181253 ATTCTGAAACTGGAGGGAGAAGG - Intergenic
992496300 5:77297511-77297533 ATGCTGATGCTGCTGGTTCAGGG + Intronic
992714627 5:79497863-79497885 ATGCTGATGCTGCTGGTCCAGGG - Intronic
995106170 5:108380813-108380835 ATGCTGCTGCTGGGCGGACAAGG + Exonic
995549077 5:113262845-113262867 ATGCTGATACTGCTGGTTCACGG + Intronic
996465639 5:123799434-123799456 ATGCTGATACTGCTGGCCCAGGG + Intergenic
996577247 5:124988975-124988997 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
998165401 5:139839815-139839837 AAGCTGATGCTGATGGGACCTGG + Intronic
998257773 5:140601693-140601715 ATGCTGAGACTGCTGGCACAGGG - Intergenic
998313604 5:141158231-141158253 ATACTGATAATTCTGGGACAGGG - Intergenic
999626678 5:153528582-153528604 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1000267973 5:159656663-159656685 CTGATGATGCTGGTGGGACATGG + Intergenic
1000348173 5:160331865-160331887 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1000568884 5:162885544-162885566 TTGCTGATACTGCTGGTCCAGGG - Intergenic
1000836407 5:166160211-166160233 ATGCTGATGCTGCTGATACAGGG + Intergenic
1001780475 5:174364625-174364647 ATGCTGATGCTGCTGGCCCAGGG - Intergenic
1002168989 5:177364870-177364892 ATGCTGATGCTGCTGGTTCAGGG - Intronic
1002185109 5:177450761-177450783 ATGCTGGTACTGCAGGGCCAGGG - Intronic
1002447067 5:179296256-179296278 ATGCTGACAATGATGGGACCCGG + Intronic
1003120590 6:3316123-3316145 ATGCTGATGCTGCTGGCCCAGGG + Intronic
1003328538 6:5110880-5110902 ATGCTGATGCTGCTGGTCCACGG + Intronic
1003633172 6:7807238-7807260 ATGCTGATGCTGCTGGTCCATGG - Intronic
1003826708 6:9960832-9960854 ATGCTGATGCTGCTGGTGCAAGG + Intronic
1004191210 6:13465383-13465405 ATGCTGATGCTGCTGGTTCATGG - Intronic
1004534775 6:16489957-16489979 ATGCTGATACTGCTGGTCCAGGG + Intronic
1004966984 6:20863172-20863194 ATGCTGATACTGCTGGTGCATGG + Intronic
1007035520 6:38669411-38669433 ATGCTGATGCTGCCGGTACAGGG + Intergenic
1007316176 6:40991004-40991026 ATGTTGATGCTGCTGGTACAAGG - Intergenic
1007981536 6:46164361-46164383 ATGTGGATGCTGGTGGGCCAGGG + Intronic
1008639651 6:53448884-53448906 ATGCTGCTACTGCTGGTCCAGGG - Intergenic
1011985555 6:93439651-93439673 CTGCTAATATTGGTGGCACATGG + Intergenic
1012445043 6:99298479-99298501 ATGCTGATACTGCTGCTCCAGGG + Intronic
1013309919 6:108884263-108884285 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1013765430 6:113568802-113568824 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1015073815 6:129130545-129130567 ATGCTGATAGTGGTGAGACATGG + Intronic
1016356377 6:143223188-143223210 ATGCTGATGCTGCTGGCACAGGG - Intronic
1016639332 6:146331002-146331024 ATGCAGAGACTGATAGGACAAGG + Intronic
1016719946 6:147284622-147284644 AGGATGATACTGGTGGTATAAGG + Intronic
1017871846 6:158493559-158493581 ATGCTGATCCTGGGGAGGCAAGG - Exonic
1017873135 6:158502941-158502963 AAGCTGACAGTGCTGGGACAGGG - Exonic
1018584848 6:165346289-165346311 ATGGTGACAGTAGTGGGACAGGG + Intronic
1020371932 7:7441735-7441757 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1020741750 7:12028630-12028652 AGGCTGCTACTGGTGAGGCATGG + Intergenic
1021441566 7:20682816-20682838 ATGATGATGCTGGAGGCACACGG + Intronic
1022047477 7:26633761-26633783 ATGCTGATGCTGTTGGTTCATGG - Intergenic
1022128499 7:27380468-27380490 ATGCTGATGCTGCTGGTCCAGGG + Intergenic
1022799402 7:33761400-33761422 ATGCTGATGCTGCTGGACCAGGG + Intergenic
1023044841 7:36201962-36201984 ATGCTGATGCTGCTGGTCCAGGG - Intronic
1023338651 7:39196264-39196286 ATGCTGATAATAGAGAGACAAGG - Intronic
1023951784 7:44852013-44852035 ATGCTGATGCTGGTGGTCTAAGG - Intergenic
1024183360 7:46920515-46920537 ACGCTTAGACTGATGGGACATGG + Intergenic
1026059253 7:67011457-67011479 ATGCTGATGCTGCTGGCTCAGGG - Intronic
1026718842 7:72813590-72813612 ATGCTGATGCTGCTGGCTCAGGG + Intronic
1027491235 7:78829275-78829297 TTTCTGATACTGGTGAGACAAGG + Intronic
1028763835 7:94527547-94527569 ATGCAAATACAAGTGGGACAAGG + Intronic
1028838493 7:95400335-95400357 ATGCTGATGCTGCTGGCCCAGGG + Intergenic
1029242527 7:99174155-99174177 ATGCTGCTGCTGGTCTGACAGGG - Intronic
1031574472 7:123398943-123398965 ATGCTGACACTGATGGGTGAGGG - Intergenic
1032442953 7:131956189-131956211 ATGCTGATGCTGCTGGTTCAGGG - Intergenic
1032989437 7:137375675-137375697 ATGCTGATACTGCTGGTCCCAGG + Intergenic
1034392436 7:150797238-150797260 ATGCTGCTATTTGTGGGAAAAGG - Intronic
1034902766 7:154917738-154917760 ATGGTGCTACTGGTGACACAAGG - Intergenic
1035022477 7:155807703-155807725 CTGCTGCTGCTGGTGGGACATGG + Intronic
1035327557 7:158074791-158074813 ATGCTGATCCTGCTGGCAGAGGG - Intronic
1035484698 7:159213654-159213676 AGGCAGATACTGGTGGGGCCTGG + Intergenic
1038411063 8:27360372-27360394 ATGCTGATGCTGATGGGAGACGG + Intronic
1039335148 8:36581030-36581052 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1042404547 8:68388859-68388881 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1042712449 8:71733633-71733655 AGGCGGATACAGATGGGACATGG + Intergenic
1043425732 8:80146917-80146939 ATGCTGATACTGCTGGTTCAGGG - Intronic
1045697592 8:104827727-104827749 ATCCTGATGCTGGTGGGCCAGGG - Intronic
1046019167 8:108643301-108643323 ATGCTGATGCTGCTGGTCCAAGG + Intronic
1047645530 8:126866126-126866148 ATGCTGATGCTGCTGGATCAAGG + Intergenic
1049180072 8:141217741-141217763 ATGCTGATACTGGTGTGAACGGG - Intronic
1050800919 9:9613073-9613095 ATGCTGATGCTGCTGGTTCAGGG + Intronic
1051055873 9:12984783-12984805 TTGATGATACTGGTGGACCAAGG + Intergenic
1051125578 9:13800864-13800886 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1051619153 9:19033870-19033892 ATGCTGGTTCTGCTGGGCCACGG + Intronic
1051677337 9:19571551-19571573 ATGCTGATGCTGTTGGTCCAAGG - Intronic
1055296317 9:74837350-74837372 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1055715531 9:79113588-79113610 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1056106827 9:83355326-83355348 ATGATAATACTGTTGGGAGAGGG - Intronic
1057396154 9:94682357-94682379 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1057897236 9:98919087-98919109 ATGCTGATACTGCCGGATCAGGG + Intergenic
1057902007 9:98956748-98956770 ATGCTGATGCTGCTGGTCCATGG - Intronic
1058233555 9:102461499-102461521 GTGCTGTTGCTGGTGGGGCAGGG + Intergenic
1058623658 9:106911572-106911594 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1060908545 9:127330021-127330043 ATGCTGATACTGCTGGCCTAGGG - Intronic
1203652542 Un_KI270751v1:141058-141080 ATGCTGATGCTGCTAGCACAGGG + Intergenic
1186610004 X:11129784-11129806 ATGCTGATGCTGCTGGGCCAGGG + Intergenic
1186883655 X:13891200-13891222 ATGCTGAGACTACTGGGCCATGG - Intronic
1186996404 X:15128225-15128247 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1187021572 X:15387930-15387952 ATGCTGATACTGCTGGTCCATGG + Intronic
1187420685 X:19131074-19131096 ATGCTGATGCTGCTGGTCCATGG + Intergenic
1188099160 X:26061435-26061457 ATGCTGATAAAGGGTGGACAGGG + Intergenic
1188350678 X:29127376-29127398 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188538722 X:31225753-31225775 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1188587140 X:31791491-31791513 GTGATGATACTGGTAGGATAGGG + Intronic
1189088569 X:38053211-38053233 ATGCTGATACTGCTGGAACAAGG + Intronic
1189124036 X:38426443-38426465 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1189166562 X:38866675-38866697 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1189862892 X:45291592-45291614 ATGCTGATGCTGCTGGTCCAGGG - Intergenic
1189871109 X:45383792-45383814 ATGCTGATGCTGCTGGTCCATGG - Intergenic
1190827605 X:54031957-54031979 ATGCTGATGCTGCTGGTCCAGGG + Intronic
1191011119 X:55760435-55760457 ATGCTGATCCTGCTGGTCCAGGG + Intergenic
1191222353 X:58003041-58003063 ATGCTGAGCTTGGTGGGGCAAGG + Intergenic
1191790738 X:64969597-64969619 ATGCTGCTGCTGGTGGTGCAGGG - Intronic
1192432429 X:71121450-71121472 ATTTTGGTACTGGTGGGGCAGGG + Intronic
1193692711 X:84667407-84667429 ATGCTGCAACTGCTGGGGCATGG - Intergenic