ID: 937706825

View in Genome Browser
Species Human (GRCh38)
Location 2:124930781-124930803
Sequence ATATATAGATAAACCTCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937706824_937706825 8 Left 937706824 2:124930750-124930772 CCACTTACACGAATGATAATATG No data
Right 937706825 2:124930781-124930803 ATATATAGATAAACCTCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937706825 Original CRISPR ATATATAGATAAACCTCACT AGG Intergenic
No off target data available for this crispr