ID: 937709776

View in Genome Browser
Species Human (GRCh38)
Location 2:124966590-124966612
Sequence CACTTCTCATTTGTGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937709776_937709778 14 Left 937709776 2:124966590-124966612 CCTTAGATCACAAATGAGAAGTG No data
Right 937709778 2:124966627-124966649 ACTACACTTTTGGAAGACATTGG No data
937709776_937709777 4 Left 937709776 2:124966590-124966612 CCTTAGATCACAAATGAGAAGTG No data
Right 937709777 2:124966617-124966639 TAAATCTATCACTACACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937709776 Original CRISPR CACTTCTCATTTGTGATCTA AGG (reversed) Intergenic
No off target data available for this crispr