ID: 937710855

View in Genome Browser
Species Human (GRCh38)
Location 2:124978494-124978516
Sequence AGCAGCAAAGGTGGCCTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937710855_937710860 1 Left 937710855 2:124978494-124978516 CCATCCAGGCCACCTTTGCTGCT No data
Right 937710860 2:124978518-124978540 CCTAACCTGCCCTTAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937710855 Original CRISPR AGCAGCAAAGGTGGCCTGGA TGG (reversed) Intergenic