ID: 937715155

View in Genome Browser
Species Human (GRCh38)
Location 2:125024234-125024256
Sequence CCCAGTGGGTACCCTGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937715148_937715155 -9 Left 937715148 2:125024220-125024242 CCAGCCCCACACCACCCAGTGGG No data
Right 937715155 2:125024234-125024256 CCCAGTGGGTACCCTGAGTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937715155 Original CRISPR CCCAGTGGGTACCCTGAGTC CGG Intergenic
No off target data available for this crispr