ID: 937716987

View in Genome Browser
Species Human (GRCh38)
Location 2:125043526-125043548
Sequence AGTGATAAGGCTGGGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937716982_937716987 8 Left 937716982 2:125043495-125043517 CCTATTTGTTTTGTAAATGTATT No data
Right 937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937716987 Original CRISPR AGTGATAAGGCTGGGTGTGG TGG Intergenic
No off target data available for this crispr