ID: 937719086

View in Genome Browser
Species Human (GRCh38)
Location 2:125071069-125071091
Sequence GAGGCTCCACAGGAGCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937719086_937719094 8 Left 937719086 2:125071069-125071091 CCCAGGTGCTCCTGTGGAGCCTC No data
Right 937719094 2:125071100-125071122 ACTGAAACACCTGAAATGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937719086 Original CRISPR GAGGCTCCACAGGAGCACCT GGG (reversed) Intergenic
No off target data available for this crispr