ID: 937735966

View in Genome Browser
Species Human (GRCh38)
Location 2:125289750-125289772
Sequence TGTCCTTTGCGGGACATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937735966_937735970 15 Left 937735966 2:125289750-125289772 CCATCCATGTCCCGCAAAGGACA No data
Right 937735970 2:125289788-125289810 TATGACTGCGTAGTATTCCATGG 0: 23
1: 1371
2: 27763
3: 15615
4: 7788

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937735966 Original CRISPR TGTCCTTTGCGGGACATGGA TGG (reversed) Intergenic
No off target data available for this crispr