ID: 937738219

View in Genome Browser
Species Human (GRCh38)
Location 2:125316937-125316959
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
937738219_937738222 -3 Left 937738219 2:125316937-125316959 CCTTCCAATCTATGAACATGAGA No data
Right 937738222 2:125316957-125316979 AGATGACTTTCCAGTTGATTGGG No data
937738219_937738221 -4 Left 937738219 2:125316937-125316959 CCTTCCAATCTATGAACATGAGA No data
Right 937738221 2:125316956-125316978 GAGATGACTTTCCAGTTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
937738219 Original CRISPR TCTCATGTTCATAGATTGGA AGG (reversed) Intergenic
No off target data available for this crispr